Incidental Mutation 'R1054:Npc2'
List |< first << previous [record 28 of 47] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Npc2
Ensembl Gene ENSMUSG00000021242
Gene NameNPC intracellular cholesterol transporter 2
SynonymsHE1, 2700012J19Rik
MMRRC Submission 039144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1054 (G1)
Quality Score225
Status Not validated
Chromosomal Location84754562-84773152 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 84760718 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021668]
Predicted Effect probably null
Transcript: ENSMUST00000021668
SMART Domains Protein: ENSMUSP00000021668
Gene: ENSMUSG00000021242

signal peptide 1 19 N/A INTRINSIC
ML 24 145 2.24e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223200
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a lipid recognition domain. The encoded protein may function in regulating the transport of cholesterol through the late endosomal/lysosomal system. Mutations in this gene have been associated with Niemann-Pick disease, type C2 and frontal lobe atrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic allele exhibit tremors, ataxia, weight loss, changes in lipid homeostasis, NK and T cell physiology, abnormal lysosome morphology, reduced NK cell number, Purkinje cell loss, and premature death. Homozygotes for a gene-trap allele show an identical immune phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 T C 15: 76,751,559 T159A probably benign Het
Arhgef38 T C 3: 133,116,465 Y763C probably damaging Het
Arv1 T A 8: 124,731,872 F245Y probably benign Het
Ccdc175 A G 12: 72,178,544 I113T possibly damaging Het
Cdc42bpb A T 12: 111,313,353 M932K probably benign Het
Cdh15 T C 8: 122,864,337 F442L possibly damaging Het
Col28a1 C T 6: 8,175,534 D105N probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cramp1l T A 17: 24,983,177 I444F probably damaging Het
Dhx32 T A 7: 133,725,272 K360M probably damaging Het
Dna2 T A 10: 62,963,823 C669S possibly damaging Het
Eif3f G A 7: 108,937,817 probably null Het
Elmod1 T C 9: 53,912,774 D310G probably benign Het
Fam105a T C 15: 27,664,549 R79G probably damaging Het
Fn1 A G 1: 71,586,214 *2272Q probably null Het
Gm12800 A G 4: 101,909,164 E15G probably benign Het
Gm8765 T C 13: 50,702,396 V690A probably benign Het
Gnat1 A G 9: 107,677,439 S76P probably damaging Het
Gtf2f2 T C 14: 75,995,445 T94A probably benign Het
Hacd4 A T 4: 88,423,027 W152R probably damaging Het
Kcnh8 A G 17: 52,803,484 Y241C probably damaging Het
Lepr T C 4: 101,782,596 I753T probably damaging Het
Med12l C T 3: 59,248,651 H1162Y probably damaging Het
Med25 C T 7: 44,880,380 A485T probably benign Het
Mup5 A T 4: 61,832,634 S145R probably benign Het
Myo1g A G 11: 6,518,987 V105A probably damaging Het
Olfr414 A G 1: 174,430,853 T142A probably benign Het
Olfr648 A G 7: 104,180,291 I39T probably benign Het
Pdzd2 A G 15: 12,371,639 S2557P probably damaging Het
Pop1 T C 15: 34,509,809 V353A probably benign Het
Pou3f2 A G 4: 22,487,536 V199A possibly damaging Het
Ptprm A T 17: 67,042,318 N43K probably damaging Het
Qrsl1 C T 10: 43,882,081 D339N probably damaging Het
Rpl13-ps3 C A 14: 58,893,945 noncoding transcript Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr16c6 A G 4: 4,069,908 V144A probably damaging Het
Spata31d1b C A 13: 59,717,518 H827N probably damaging Het
Taf4b T A 18: 14,821,473 H535Q probably benign Het
Timmdc1 A G 16: 38,522,428 V36A probably benign Het
Tmem74b C T 2: 151,706,419 A22V probably benign Het
Txnrd3 T A 6: 89,650,561 Y65* probably null Het
Vmn1r200 T A 13: 22,395,454 S133R probably damaging Het
Vwf G A 6: 125,590,227 C311Y probably damaging Het
Wipf2 G A 11: 98,896,315 R390H possibly damaging Het
Zfp282 T A 6: 47,904,599 S407T probably benign Het
Other mutations in Npc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Npc2 APN 12 84772845 missense possibly damaging 0.83
R1251:Npc2 UTSW 12 84760884 missense probably damaging 1.00
R1986:Npc2 UTSW 12 84760749 missense probably benign 0.18
R6208:Npc2 UTSW 12 84757145 missense probably damaging 1.00
R7130:Npc2 UTSW 12 84765307 missense probably damaging 1.00
R8116:Npc2 UTSW 12 84760838 missense probably benign 0.12
R8416:Npc2 UTSW 12 84765357 missense probably damaging 0.96
R8531:Npc2 UTSW 12 84760838 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acttcttggtagagtggacttg -3'
Posted On2014-01-05