Incidental Mutation 'R1054:Ptprm'
Institutional Source Beutler Lab
Gene Symbol Ptprm
Ensembl Gene ENSMUSG00000033278
Gene Nameprotein tyrosine phosphatase, receptor type, M
MMRRC Submission 039144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1054 (G1)
Quality Score225
Status Not validated
Chromosomal Location66666947-67354457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67042318 bp
Amino Acid Change Asparagine to Lysine at position 43 (N43K)
Ref Sequence ENSEMBL: ENSMUSP00000153179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037974] [ENSMUST00000223982] [ENSMUST00000224091] [ENSMUST00000224862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037974
AA Change: N303K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045603
Gene: ENSMUSG00000033278
AA Change: N303K

signal peptide 1 19 N/A INTRINSIC
MAM 22 184 2.81e-73 SMART
IG 191 279 2.1e-6 SMART
FN3 281 364 6.35e-4 SMART
FN3 380 468 2.81e-5 SMART
FN3 482 572 3.7e-5 SMART
transmembrane domain 743 764 N/A INTRINSIC
low complexity region 765 774 N/A INTRINSIC
PTPc 899 1156 5.26e-135 SMART
PTPc 1185 1450 9.46e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223982
AA Change: N303K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224091
AA Change: N303K

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000224862
AA Change: N43K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP has been shown to mediate cell-cell aggregation through the interaction with another molecule of this PTP on an adjacent cell. This PTP can interact with scaffolding protein RACK1/GNB2L1, which may be necessary for the downstream signaling in response to cell-cell adhesion. Alternative splicing results in multiple transcripts encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired flow-induced dilation in mesenteric resistance arteries. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 T C 15: 76,751,559 T159A probably benign Het
Arhgef38 T C 3: 133,116,465 Y763C probably damaging Het
Arv1 T A 8: 124,731,872 F245Y probably benign Het
Ccdc175 A G 12: 72,178,544 I113T possibly damaging Het
Cdc42bpb A T 12: 111,313,353 M932K probably benign Het
Cdh15 T C 8: 122,864,337 F442L possibly damaging Het
Col28a1 C T 6: 8,175,534 D105N probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cramp1l T A 17: 24,983,177 I444F probably damaging Het
Dhx32 T A 7: 133,725,272 K360M probably damaging Het
Dna2 T A 10: 62,963,823 C669S possibly damaging Het
Eif3f G A 7: 108,937,817 probably null Het
Elmod1 T C 9: 53,912,774 D310G probably benign Het
Fam105a T C 15: 27,664,549 R79G probably damaging Het
Fn1 A G 1: 71,586,214 *2272Q probably null Het
Gm12800 A G 4: 101,909,164 E15G probably benign Het
Gm8765 T C 13: 50,702,396 V690A probably benign Het
Gnat1 A G 9: 107,677,439 S76P probably damaging Het
Gtf2f2 T C 14: 75,995,445 T94A probably benign Het
Hacd4 A T 4: 88,423,027 W152R probably damaging Het
Kcnh8 A G 17: 52,803,484 Y241C probably damaging Het
Lepr T C 4: 101,782,596 I753T probably damaging Het
Med12l C T 3: 59,248,651 H1162Y probably damaging Het
Med25 C T 7: 44,880,380 A485T probably benign Het
Mup5 A T 4: 61,832,634 S145R probably benign Het
Myo1g A G 11: 6,518,987 V105A probably damaging Het
Npc2 A G 12: 84,760,718 probably null Het
Olfr414 A G 1: 174,430,853 T142A probably benign Het
Olfr648 A G 7: 104,180,291 I39T probably benign Het
Pdzd2 A G 15: 12,371,639 S2557P probably damaging Het
Pop1 T C 15: 34,509,809 V353A probably benign Het
Pou3f2 A G 4: 22,487,536 V199A possibly damaging Het
Qrsl1 C T 10: 43,882,081 D339N probably damaging Het
Rpl13-ps3 C A 14: 58,893,945 noncoding transcript Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr16c6 A G 4: 4,069,908 V144A probably damaging Het
Spata31d1b C A 13: 59,717,518 H827N probably damaging Het
Taf4b T A 18: 14,821,473 H535Q probably benign Het
Timmdc1 A G 16: 38,522,428 V36A probably benign Het
Tmem74b C T 2: 151,706,419 A22V probably benign Het
Txnrd3 T A 6: 89,650,561 Y65* probably null Het
Vmn1r200 T A 13: 22,395,454 S133R probably damaging Het
Vwf G A 6: 125,590,227 C311Y probably damaging Het
Wipf2 G A 11: 98,896,315 R390H possibly damaging Het
Zfp282 T A 6: 47,904,599 S407T probably benign Het
Other mutations in Ptprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Ptprm APN 17 66817972 missense probably damaging 1.00
IGL01128:Ptprm APN 17 67042101 missense probably damaging 1.00
IGL01509:Ptprm APN 17 66762213 missense possibly damaging 0.95
IGL01785:Ptprm APN 17 66685623 missense probably damaging 1.00
IGL01912:Ptprm APN 17 67046118 missense probably benign 0.13
IGL01929:Ptprm APN 17 66690549 missense probably damaging 1.00
IGL01937:Ptprm APN 17 67046163 splice site probably benign
IGL01939:Ptprm APN 17 67063163 splice site probably benign
IGL02053:Ptprm APN 17 66693841 missense probably damaging 1.00
IGL02203:Ptprm APN 17 66953123 missense probably damaging 1.00
IGL02468:Ptprm APN 17 66814509 missense probably benign 0.02
IGL02500:Ptprm APN 17 66920048 missense probably damaging 0.99
IGL02542:Ptprm APN 17 66920150 missense probably benign
Becalming UTSW 17 66944332 splice site probably null
Pacifying UTSW 17 66683408 missense possibly damaging 0.74
R0674:Ptprm UTSW 17 67191341 missense possibly damaging 0.52
R0709:Ptprm UTSW 17 66944332 splice site probably null
R1522:Ptprm UTSW 17 66693871 missense possibly damaging 0.91
R1561:Ptprm UTSW 17 66940541 missense probably damaging 1.00
R1726:Ptprm UTSW 17 67042327 missense probably damaging 1.00
R1744:Ptprm UTSW 17 66689366 missense probably damaging 1.00
R1873:Ptprm UTSW 17 66688355 missense probably damaging 1.00
R1951:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1952:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1953:Ptprm UTSW 17 66940580 missense probably benign 0.07
R1993:Ptprm UTSW 17 66747160 missense probably damaging 1.00
R2017:Ptprm UTSW 17 66957153 splice site probably null
R2266:Ptprm UTSW 17 66725851 splice site probably null
R2417:Ptprm UTSW 17 66944326 missense probably damaging 0.97
R2511:Ptprm UTSW 17 66693778 missense probably damaging 1.00
R3726:Ptprm UTSW 17 66956860 missense possibly damaging 0.91
R3824:Ptprm UTSW 17 66809575 missense probably benign 0.40
R4057:Ptprm UTSW 17 67075663 missense possibly damaging 0.93
R4113:Ptprm UTSW 17 66725813 missense probably damaging 1.00
R4559:Ptprm UTSW 17 66683408 missense possibly damaging 0.74
R4598:Ptprm UTSW 17 67095497 missense probably benign 0.00
R4742:Ptprm UTSW 17 66744751 nonsense probably null
R4974:Ptprm UTSW 17 66678067 missense probably benign 0.01
R5157:Ptprm UTSW 17 66957097 missense probably benign 0.09
R5433:Ptprm UTSW 17 66693473 missense probably damaging 1.00
R5509:Ptprm UTSW 17 66689358 missense probably damaging 1.00
R5586:Ptprm UTSW 17 66920196 missense probably damaging 1.00
R5820:Ptprm UTSW 17 66689465 missense probably damaging 1.00
R5867:Ptprm UTSW 17 67045981 splice site probably null
R6044:Ptprm UTSW 17 66693862 missense probably damaging 1.00
R6229:Ptprm UTSW 17 66688300 missense probably damaging 1.00
R6615:Ptprm UTSW 17 67353956 critical splice donor site probably null
R6969:Ptprm UTSW 17 66912418 missense possibly damaging 0.63
R7135:Ptprm UTSW 17 66944288 missense possibly damaging 0.93
R7161:Ptprm UTSW 17 66809627 missense probably benign 0.21
R7410:Ptprm UTSW 17 66693566 missense probably damaging 0.99
R7476:Ptprm UTSW 17 66725791 missense probably benign 0.01
R7789:Ptprm UTSW 17 67095539 missense probably damaging 1.00
R8027:Ptprm UTSW 17 66944205 missense probably damaging 1.00
R8089:Ptprm UTSW 17 66683488 missense possibly damaging 0.63
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aattgagtaccagaaatcaaaccc -3'
Posted On2014-01-05