Incidental Mutation 'R1055:Ahctf1'
ID94244
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 179763486 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1243 (T1243I)
Ref Sequence ENSEMBL: ENSMUSP00000027768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000127250] [ENSMUST00000145968]
PDB Structure
Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027768
AA Change: T1243I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: T1243I

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127250
Predicted Effect probably benign
Transcript: ENSMUST00000145968
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4681:Ahctf1 UTSW 1 179752796 missense probably benign 0.27
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R6998:Ahctf1 UTSW 1 179770915 nonsense probably null
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179753381 missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179790314 missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179762846 missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179770848 missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179768315 missense probably benign
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTCAGTTTCTGCTGGAAGTCCAC -3'
(R):5'- ATCTTTGGCTCTGTCAGCCACG -3'

Sequencing Primer
(F):5'- TAAAATGGCACTCCACAGTCTTTC -3'
(R):5'- ACGTCTTCTGGATTTGCCGAG -3'
Posted On2014-01-05