Mutagenetix > Incidental Mutations

Incidental Mutation 'R1055:Arhgef11'

94253

Institutional Source

Beutler Lab

Gene Symbol

Arhgef11

Ensembl Gene

ENSMUSG00000041977

Gene Name

Rho guanine nucleotide exchange factor (GEF) 11

Synonyms

Prg, PDZ-RhoGEF

MMRRC Submission

039145-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87617559-87738034 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 87717118 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 539 (T539P)

Ref Sequence

ENSEMBL: ENSMUSP00000122166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006]

Predicted Effect

probably benign
Transcript: ENSMUST00000039476
AA Change: T539P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977
AA Change: T539P

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC
low complexity region	625	639	N/A	INTRINSIC
low complexity region	681	694	N/A	INTRINSIC
RhoGEF	768	952	1.11e-65	SMART
PH	996	1111	9.49e-6	SMART
low complexity region	1153	1166	N/A	INTRINSIC
low complexity region	1176	1188	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1357	1367	N/A	INTRINSIC
low complexity region	1478	1490	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129113
AA Change: T499P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977
AA Change: T499P

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
RGS	313	432	3.36e-11	SMART
low complexity region	596	610	N/A	INTRINSIC
low complexity region	652	665	N/A	INTRINSIC
RhoGEF	739	923	1.11e-65	SMART
PH	967	1082	9.49e-6	SMART
low complexity region	1124	1137	N/A	INTRINSIC
low complexity region	1147	1159	N/A	INTRINSIC
low complexity region	1304	1314	N/A	INTRINSIC
low complexity region	1328	1338	N/A	INTRINSIC
low complexity region	1449	1461	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142799

Predicted Effect

probably benign
Transcript: ENSMUST00000152006
AA Change: T539P

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977
AA Change: T539P

Domain	Start	End	E-Value	Type
low complexity region	12	18	N/A	INTRINSIC
PDZ	55	123	2.45e-18	SMART
low complexity region	149	160	N/A	INTRINSIC
coiled coil region	205	231	N/A	INTRINSIC
RGS	353	472	3.36e-11	SMART
low complexity region	554	565	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.3%
10x: 95.3%
20x: 87.5%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	A	G	14: 63,973,275	V168A	possibly damaging	Het
A1cf	C	A	19: 31,932,519	T237N	probably benign	Het
Actl10	A	T	2: 154,552,668	Q180L	probably benign	Het
Adcy1	T	C	11: 7,109,075	L327P	probably damaging	Het
Adcy7	T	C	8: 88,318,057		probably benign	Het
Ahctf1	G	A	1: 179,763,486	T1243I	possibly damaging	Het
Akap6	C	T	12: 52,880,672	Q122*	probably null	Het
Apob	G	A	12: 7,994,963	G861D	probably damaging	Het
Cd244	T	A	1: 171,577,276	V232E	probably damaging	Het
Chia1	A	C	3: 106,130,883	D365A	probably damaging	Het
Clpsl2	C	T	17: 28,549,526	Q5*	probably null	Het
Clrn1	T	A	3: 58,865,110	I117F	probably benign	Het
Csmd3	A	G	15: 47,881,537	L1354P	probably damaging	Het
Csn2	G	A	5: 87,694,737	P144S	possibly damaging	Het
D17Wsu92e	T	C	17: 27,767,936	N272S	probably damaging	Het
Dcdc2a	T	A	13: 25,102,610	M172K	probably damaging	Het
Dnah9	A	T	11: 66,160,011	W152R	probably damaging	Het
Dnmt3a	T	A	12: 3,872,864	S82T	probably benign	Het
Ebf1	A	G	11: 44,632,775	K146E	probably damaging	Het
Gfpt2	A	C	11: 49,827,211	R504S	probably damaging	Het
Gpank1	T	A	17: 35,124,308	S255T	probably damaging	Het
Greb1	T	C	12: 16,682,251	M1570V	probably damaging	Het
Gtf2i	A	T	5: 134,263,624	I403K	probably damaging	Het
Hoxc11	T	A	15: 102,954,835	C104S	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Khdrbs2	A	T	1: 32,644,157		probably benign	Het
Lix1l	G	T	3: 96,621,310	G200V	probably damaging	Het
Lrrc23	T	C	6: 124,778,151	N141S	probably damaging	Het
March11	A	T	15: 26,309,662	D134V	probably damaging	Het
Myo9a	A	T	9: 59,855,370	T795S	probably benign	Het
Nhsl1	T	A	10: 18,525,475	D782E	probably benign	Het
Nptxr	T	C	15: 79,790,255		probably benign	Het
Nrp1	A	G	8: 128,468,598	M512V	possibly damaging	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1126	ATTGCTACTC	A	2: 87,457,437		probably benign	Het
Olfr1469	G	A	19: 13,411,390	A274T	probably benign	Het
Pard3	T	C	8: 127,378,280	F267S	probably benign	Het
Pomt2	G	A	12: 87,147,480	T50M	possibly damaging	Het
Qsox2	A	G	2: 26,214,125	Y298H	probably damaging	Het
Rabgap1	A	G	2: 37,492,068	K450E	possibly damaging	Het
Rpa1	A	T	11: 75,302,732	V591D	probably damaging	Het
Sall3	A	C	18: 80,969,792	M1143R	probably benign	Het
Scgb1b19	G	T	7: 33,287,343	A13S	unknown	Het
Scn1a	T	C	2: 66,337,996	T89A	probably benign	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sdr42e1	T	G	8: 117,663,584	N106T	probably damaging	Het
Shpk	A	T	11: 73,215,119	M266L	probably benign	Het
Slc34a1	G	T	13: 55,403,033	R139L	probably benign	Het
Smbd1	C	A	16: 32,806,718	D67Y	probably damaging	Het
Srd5a3	A	G	5: 76,153,638	N238S	probably benign	Het
Tmprss2	T	C	16: 97,576,262	N212D	probably damaging	Het
Uap1	G	T	1: 170,156,911		probably benign	Het
Ugt1a6a	A	G	1: 88,139,014	M181V	probably benign	Het
Vmn2r32	C	T	7: 7,474,327	W355*	probably null	Het
Vmn2r86	T	A	10: 130,446,357	S797C	probably damaging	Het
Wiz	A	G	17: 32,387,642	S40P	probably damaging	Het
Zfand6	A	G	7: 84,615,973		probably benign	Het
Zfp280d	G	A	9: 72,329,167		probably null	Het

Other mutations in Arhgef11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Arhgef11	APN	3	87729503	missense	probably damaging	1.00
IGL00900:Arhgef11	APN	3	87683560	missense	possibly damaging	0.71
IGL01291:Arhgef11	APN	3	87733174	missense	probably benign	0.00
IGL01475:Arhgef11	APN	3	87727126	splice site	probably benign
IGL01599:Arhgef11	APN	3	87737046	missense	probably benign
IGL02251:Arhgef11	APN	3	87683547	missense	probably damaging	1.00
IGL02651:Arhgef11	APN	3	87698864	missense	probably damaging	0.99
IGL02884:Arhgef11	APN	3	87728006	missense	probably damaging	1.00
IGL02900:Arhgef11	APN	3	87733160	missense	probably benign	0.07
IGL03017:Arhgef11	APN	3	87717060	nonsense	probably null
ANU05:Arhgef11	UTSW	3	87733174	missense	probably benign	0.00
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0049:Arhgef11	UTSW	3	87729193	splice site	probably null
R0129:Arhgef11	UTSW	3	87728063	missense	probably damaging	1.00
R0486:Arhgef11	UTSW	3	87688852	splice site	probably null
R0698:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0701:Arhgef11	UTSW	3	87733459	missense	probably benign	0.24
R0849:Arhgef11	UTSW	3	87735896	missense	probably benign	0.24
R1256:Arhgef11	UTSW	3	87727135	missense	possibly damaging	0.81
R1401:Arhgef11	UTSW	3	87733469	nonsense	probably null
R1543:Arhgef11	UTSW	3	87713017	missense	probably benign	0.10
R1547:Arhgef11	UTSW	3	87695402	missense	possibly damaging	0.87
R1564:Arhgef11	UTSW	3	87702510	missense	probably benign
R1675:Arhgef11	UTSW	3	87731211	missense	possibly damaging	0.84
R2082:Arhgef11	UTSW	3	87725996	missense	possibly damaging	0.47
R2293:Arhgef11	UTSW	3	87727990	missense	probably damaging	1.00
R4739:Arhgef11	UTSW	3	87697999	missense	possibly damaging	0.47
R4930:Arhgef11	UTSW	3	87728594	missense	probably damaging	1.00
R5130:Arhgef11	UTSW	3	87726014	missense	possibly damaging	0.71
R5151:Arhgef11	UTSW	3	87735360	missense	probably damaging	1.00
R5157:Arhgef11	UTSW	3	87728510	splice site	probably null
R5203:Arhgef11	UTSW	3	87735357	missense	probably damaging	1.00
R5329:Arhgef11	UTSW	3	87679752	intron	probably benign
R5615:Arhgef11	UTSW	3	87722485	critical splice donor site	probably null
R5646:Arhgef11	UTSW	3	87684486	missense	possibly damaging	0.94
R6125:Arhgef11	UTSW	3	87729602	missense	probably damaging	1.00
R6242:Arhgef11	UTSW	3	87728078	missense	probably benign
R6543:Arhgef11	UTSW	3	87733408	missense	probably benign	0.09
R6801:Arhgef11	UTSW	3	87735852	missense	possibly damaging	0.53
R6939:Arhgef11	UTSW	3	87686920	missense	probably damaging	1.00
R7008:Arhgef11	UTSW	3	87729218	missense	possibly damaging	0.92
R7155:Arhgef11	UTSW	3	87709572	nonsense	probably null
R7169:Arhgef11	UTSW	3	87727448	missense	possibly damaging	0.79
R7325:Arhgef11	UTSW	3	87713292	missense	possibly damaging	0.62
R7392:Arhgef11	UTSW	3	87717175	critical splice donor site	probably null
R7683:Arhgef11	UTSW	3	87722383	missense	probably damaging	0.98
R7875:Arhgef11	UTSW	3	87684501	missense	probably damaging	1.00
R7912:Arhgef11	UTSW	3	87733222	missense	probably damaging	1.00
R7980:Arhgef11	UTSW	3	87697990	missense	probably benign	0.01
R8028:Arhgef11	UTSW	3	87735552	missense	probably benign
R8081:Arhgef11	UTSW	3	87725642	missense	probably damaging	1.00
R8118:Arhgef11	UTSW	3	87735857	missense	probably damaging	1.00
R8207:Arhgef11	UTSW	3	87698775	missense	possibly damaging	0.71
R8290:Arhgef11	UTSW	3	87725968	missense	probably damaging	1.00
R8443:Arhgef11	UTSW	3	87713099	missense	probably benign	0.17
R8543:Arhgef11	UTSW	3	87681874	missense	probably damaging	1.00
X0011:Arhgef11	UTSW	3	87722406	missense	probably benign
Z1176:Arhgef11	UTSW	3	87735462	missense	not run

Predicted Primers

PCR Primer
(F):5'- AAGGGACTTTGTGTTCCCATCCAC -3'
(R):5'- TGCTGCTCTGCTGAGATAGGAGAC -3'

Sequencing Primer
(F):5'- CAGTTGCATTTGATCATCCAGAC -3'
(R):5'- TCACTAGAGAGCTGACTCAGG -3'

Posted On

2014-01-05