Incidental Mutation 'R1055:Sdr42e1'
ID94277
Institutional Source Beutler Lab
Gene Symbol Sdr42e1
Ensembl Gene ENSMUSG00000034308
Gene Nameshort chain dehydrogenase/reductase family 42E, member 1
Synonyms
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117661399-117673689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 117663584 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 106 (N106T)
Ref Sequence ENSEMBL: ENSMUSP00000133837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037955] [ENSMUST00000173522] [ENSMUST00000174450]
Predicted Effect probably damaging
Transcript: ENSMUST00000037955
AA Change: N106T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044457
Gene: ENSMUSG00000034308
AA Change: N106T

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 241 4.2e-14 PFAM
Pfam:Polysacc_synt_2 11 129 7.1e-11 PFAM
Pfam:NAD_binding_10 11 239 3.3e-10 PFAM
Pfam:Epimerase 11 255 6.7e-29 PFAM
Pfam:3Beta_HSD 12 285 3.1e-69 PFAM
Pfam:NAD_binding_4 27 233 7.1e-14 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173522
AA Change: N106T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133782
Gene: ENSMUSG00000034308
AA Change: N106T

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 208 2.4e-13 PFAM
Pfam:Polysacc_synt_2 11 129 5.2e-11 PFAM
Pfam:Epimerase 11 250 4.3e-28 PFAM
Pfam:GDP_Man_Dehyd 12 273 1.3e-9 PFAM
Pfam:3Beta_HSD 12 285 4.7e-69 PFAM
Pfam:NAD_binding_4 27 233 2.1e-11 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174450
AA Change: N106T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133837
Gene: ENSMUSG00000034308
AA Change: N106T

DomainStartEndE-ValueType
Pfam:adh_short 9 136 1.1e-6 PFAM
Pfam:RmlD_sub_bind 9 184 6.7e-15 PFAM
Pfam:Polysacc_synt_2 11 129 6e-12 PFAM
Pfam:Epimerase 11 176 1.8e-21 PFAM
Pfam:NAD_binding_10 11 189 4.8e-10 PFAM
Pfam:3Beta_HSD 12 189 5.4e-43 PFAM
Pfam:NAD_binding_4 25 186 6.6e-11 PFAM
Meta Mutation Damage Score 0.4568 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Sdr42e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Sdr42e1 APN 8 117663443 missense probably damaging 1.00
IGL01613:Sdr42e1 APN 8 117662937 missense probably benign 0.14
PIT4581001:Sdr42e1 UTSW 8 117663518 missense probably damaging 0.99
R0194:Sdr42e1 UTSW 8 117663109 missense probably damaging 1.00
R2108:Sdr42e1 UTSW 8 117665024 missense probably damaging 0.99
R2176:Sdr42e1 UTSW 8 117662877 missense possibly damaging 0.63
R2907:Sdr42e1 UTSW 8 117662772 missense probably damaging 0.99
R4551:Sdr42e1 UTSW 8 117663608 missense probably benign 0.01
R4651:Sdr42e1 UTSW 8 117663621 missense probably benign 0.01
R5148:Sdr42e1 UTSW 8 117663603 missense probably damaging 1.00
R5240:Sdr42e1 UTSW 8 117663282 missense probably benign 0.00
R6242:Sdr42e1 UTSW 8 117663197 missense possibly damaging 0.87
R7417:Sdr42e1 UTSW 8 117662751 missense probably benign 0.04
R7716:Sdr42e1 UTSW 8 117673647 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACCTTCTTCTCTGCGATGGACTTG -3'
(R):5'- AGGAGCCCGTGTGATTCTGTTTGAC -3'

Sequencing Primer
(F):5'- CTTGGTCCTGGAGTAGTGATCC -3'
(R):5'- GTGATTCTGTTTGACATCACCCAAC -3'
Posted On2014-01-05