Incidental Mutation 'R1055:Adcy1'
ID94285
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Nameadenylate cyclase 1
SynonymsI-AC, D11Bwg1392e, AC1
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location7063489-7178506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7109075 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 327 (L327P)
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
Predicted Effect probably damaging
Transcript: ENSMUST00000020706
AA Change: L327P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: L327P

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Meta Mutation Damage Score 0.9752 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7137385 missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7064102 missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7169414 missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7167143 missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7100565 splice site probably benign
IGL01945:Adcy1 APN 11 7161891 missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7144737 missense probably benign 0.26
IGL02649:Adcy1 APN 11 7167156 missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7138279 splice site probably benign
IGL02813:Adcy1 APN 11 7146591 missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7079012 missense probably benign 0.19
IGL03116:Adcy1 APN 11 7150071 missense probably benign
IGL03119:Adcy1 APN 11 7109051 missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7167054 splice site probably benign
PIT4431001:Adcy1 UTSW 11 7064089 missense possibly damaging 0.93
PIT4520001:Adcy1 UTSW 11 7167133 missense probably damaging 1.00
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7149497 splice site probably benign
R0082:Adcy1 UTSW 11 7149497 splice site probably benign
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7149538 missense probably benign 0.08
R0569:Adcy1 UTSW 11 7146514 missense probably benign 0.34
R1144:Adcy1 UTSW 11 7137400 missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7167054 splice site probably null
R1245:Adcy1 UTSW 11 7169410 splice site probably benign
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1823:Adcy1 UTSW 11 7161312 missense probably benign 0.23
R1953:Adcy1 UTSW 11 7078991 missense probably benign 0.01
R1957:Adcy1 UTSW 11 7161945 missense probably benign 0.00
R2029:Adcy1 UTSW 11 7139142 missense probably benign 0.10
R2051:Adcy1 UTSW 11 7161885 nonsense probably null
R2483:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3108:Adcy1 UTSW 11 7169453 missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3624:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R4082:Adcy1 UTSW 11 7064117 missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7063889 missense probably damaging 1.00
R4470:Adcy1 UTSW 11 7144804 missense probably benign 0.17
R4472:Adcy1 UTSW 11 7130369 missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7138336 missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7161298 missense probably benign 0.25
R5237:Adcy1 UTSW 11 7149553 missense probably benign 0.00
R5288:Adcy1 UTSW 11 7161351 missense probably benign 0.01
R5304:Adcy1 UTSW 11 7064198 missense probably benign 0.00
R5341:Adcy1 UTSW 11 7130375 missense probably damaging 0.99
R5379:Adcy1 UTSW 11 7146532 missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7139088 nonsense probably null
R5677:Adcy1 UTSW 11 7161914 missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7109020 missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7130300 missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7139095 missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7161337 missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7161367 missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7150884 missense possibly damaging 0.81
R6998:Adcy1 UTSW 11 7079026 missense probably damaging 1.00
R7368:Adcy1 UTSW 11 7144765 missense probably damaging 1.00
R7378:Adcy1 UTSW 11 7169543 missense possibly damaging 0.56
R7393:Adcy1 UTSW 11 7137381 missense probably damaging 1.00
R7500:Adcy1 UTSW 11 7144762 missense probably damaging 1.00
R7529:Adcy1 UTSW 11 7139157 missense probably damaging 0.98
X0027:Adcy1 UTSW 11 7161930 missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7150019 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCCCCAGTGTAGATGCAGTTATGTG -3'
(R):5'- TTTCCAGACCAGAAGGGTGGCAAG -3'

Sequencing Primer
(F):5'- CTAATCCCTCTGTAGTCAAGAGGTG -3'
(R):5'- ACAGTCAAGGCTGCTTCAG -3'
Posted On2014-01-05