Incidental Mutation 'R1055:Greb1'
ID 94295
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
MMRRC Submission 039145-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1055 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 16670615-16800886 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16682251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1570 (M1570V)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: M1570V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: M1570V

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159120
AA Change: M1542V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: M1542V

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160755
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: M1570V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: M1570V

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223113
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 (GRCm38) V168A possibly damaging Het
A1cf C A 19: 31,932,519 (GRCm38) T237N probably benign Het
Actl10 A T 2: 154,552,668 (GRCm38) Q180L probably benign Het
Adcy1 T C 11: 7,109,075 (GRCm38) L327P probably damaging Het
Adcy7 T C 8: 88,318,057 (GRCm38) probably benign Het
Ahctf1 G A 1: 179,763,486 (GRCm38) T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 (GRCm38) Q122* probably null Het
Apob G A 12: 7,994,963 (GRCm38) G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 (GRCm38) T539P probably benign Het
Cd244 T A 1: 171,577,276 (GRCm38) V232E probably damaging Het
Chia1 A C 3: 106,130,883 (GRCm38) D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 (GRCm38) Q5* probably null Het
Clrn1 T A 3: 58,865,110 (GRCm38) I117F probably benign Het
Csmd3 A G 15: 47,881,537 (GRCm38) L1354P probably damaging Het
Csn2 G A 5: 87,694,737 (GRCm38) P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 (GRCm38) N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 (GRCm38) M172K probably damaging Het
Dnah9 A T 11: 66,160,011 (GRCm38) W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 (GRCm38) S82T probably benign Het
Ebf1 A G 11: 44,632,775 (GRCm38) K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 (GRCm38) R504S probably damaging Het
Gpank1 T A 17: 35,124,308 (GRCm38) S255T probably damaging Het
Gtf2i A T 5: 134,263,624 (GRCm38) I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 (GRCm38) C104S probably damaging Het
Hsh2d G A 8: 72,200,460 (GRCm38) D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 (GRCm38) probably benign Het
Lix1l G T 3: 96,621,310 (GRCm38) G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 (GRCm38) N141S probably damaging Het
March11 A T 15: 26,309,662 (GRCm38) D134V probably damaging Het
Myo9a A T 9: 59,855,370 (GRCm38) T795S probably benign Het
Nhsl1 T A 10: 18,525,475 (GRCm38) D782E probably benign Het
Nptxr T C 15: 79,790,255 (GRCm38) probably benign Het
Nrp1 A G 8: 128,468,598 (GRCm38) M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 (GRCm38) G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 (GRCm38) probably benign Het
Olfr1469 G A 19: 13,411,390 (GRCm38) A274T probably benign Het
Pard3 T C 8: 127,378,280 (GRCm38) F267S probably benign Het
Pomt2 G A 12: 87,147,480 (GRCm38) T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 (GRCm38) Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 (GRCm38) K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 (GRCm38) V591D probably damaging Het
Sall3 A C 18: 80,969,792 (GRCm38) M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 (GRCm38) A13S unknown Het
Scn1a T C 2: 66,337,996 (GRCm38) T89A probably benign Het
Sdk2 C T 11: 113,838,646 (GRCm38) silent Het
Sdr42e1 T G 8: 117,663,584 (GRCm38) N106T probably damaging Het
Shpk A T 11: 73,215,119 (GRCm38) M266L probably benign Het
Slc34a1 G T 13: 55,403,033 (GRCm38) R139L probably benign Het
Smbd1 C A 16: 32,806,718 (GRCm38) D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 (GRCm38) N238S probably benign Het
Tmprss2 T C 16: 97,576,262 (GRCm38) N212D probably damaging Het
Uap1 G T 1: 170,156,911 (GRCm38) probably benign Het
Ugt1a6a A G 1: 88,139,014 (GRCm38) M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 (GRCm38) W355* probably null Het
Vmn2r86 T A 10: 130,446,357 (GRCm38) S797C probably damaging Het
Wiz A G 17: 32,387,642 (GRCm38) S40P probably damaging Het
Zfand6 A G 7: 84,615,973 (GRCm38) probably benign Het
Zfp280d G A 9: 72,329,167 (GRCm38) probably null Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16,711,961 (GRCm38) missense probably damaging 1.00
IGL01316:Greb1 APN 12 16,698,586 (GRCm38) missense probably benign 0.04
IGL01464:Greb1 APN 12 16,714,826 (GRCm38) missense probably damaging 0.99
IGL01474:Greb1 APN 12 16,684,501 (GRCm38) missense probably benign
IGL01522:Greb1 APN 12 16,701,201 (GRCm38) missense probably damaging 1.00
IGL01824:Greb1 APN 12 16,711,716 (GRCm38) nonsense probably null
IGL01837:Greb1 APN 12 16,684,451 (GRCm38) missense probably benign 0.19
IGL01991:Greb1 APN 12 16,699,681 (GRCm38) missense probably damaging 1.00
IGL01996:Greb1 APN 12 16,690,845 (GRCm38) missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16,706,232 (GRCm38) missense probably damaging 1.00
IGL02267:Greb1 APN 12 16,717,208 (GRCm38) missense probably benign 0.00
IGL02512:Greb1 APN 12 16,692,712 (GRCm38) missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16,706,295 (GRCm38) splice site probably benign
IGL02613:Greb1 APN 12 16,739,888 (GRCm38) critical splice donor site probably null
IGL02648:Greb1 APN 12 16,708,682 (GRCm38) missense probably damaging 1.00
IGL02679:Greb1 APN 12 16,708,723 (GRCm38) missense probably damaging 1.00
begraben UTSW 12 16,684,373 (GRCm38) missense possibly damaging 0.51
Eared UTSW 12 16,673,863 (GRCm38) missense probably damaging 1.00
Humpback UTSW 12 16,701,171 (GRCm38) missense probably damaging 1.00
pied_billed UTSW 12 16,724,857 (GRCm38) missense possibly damaging 0.79
rednecked UTSW 12 16,682,152 (GRCm38) missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16,688,567 (GRCm38) missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16,733,331 (GRCm38) missense probably damaging 1.00
R0083:Greb1 UTSW 12 16,696,451 (GRCm38) missense probably benign
R0100:Greb1 UTSW 12 16,680,224 (GRCm38) missense probably benign 0.41
R0100:Greb1 UTSW 12 16,680,224 (GRCm38) missense probably benign 0.41
R0220:Greb1 UTSW 12 16,682,286 (GRCm38) missense probably damaging 1.00
R0245:Greb1 UTSW 12 16,696,456 (GRCm38) missense probably damaging 1.00
R0540:Greb1 UTSW 12 16,682,193 (GRCm38) missense probably damaging 1.00
R0547:Greb1 UTSW 12 16,723,411 (GRCm38) missense probably benign
R0563:Greb1 UTSW 12 16,680,267 (GRCm38) missense probably benign 0.23
R0607:Greb1 UTSW 12 16,682,193 (GRCm38) missense probably damaging 1.00
R0610:Greb1 UTSW 12 16,696,442 (GRCm38) missense probably benign
R0652:Greb1 UTSW 12 16,696,456 (GRCm38) missense probably damaging 1.00
R0659:Greb1 UTSW 12 16,680,212 (GRCm38) missense probably damaging 0.99
R0945:Greb1 UTSW 12 16,673,802 (GRCm38) missense probably benign 0.31
R1445:Greb1 UTSW 12 16,707,851 (GRCm38) missense probably damaging 1.00
R1471:Greb1 UTSW 12 16,711,774 (GRCm38) missense probably damaging 0.97
R1503:Greb1 UTSW 12 16,724,819 (GRCm38) nonsense probably null
R1566:Greb1 UTSW 12 16,711,828 (GRCm38) missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16,701,171 (GRCm38) missense probably damaging 1.00
R1623:Greb1 UTSW 12 16,674,770 (GRCm38) missense probably damaging 1.00
R1751:Greb1 UTSW 12 16,723,438 (GRCm38) splice site probably benign
R1778:Greb1 UTSW 12 16,690,894 (GRCm38) missense probably benign
R1842:Greb1 UTSW 12 16,696,243 (GRCm38) missense probably damaging 1.00
R2040:Greb1 UTSW 12 16,702,650 (GRCm38) missense probably damaging 1.00
R2153:Greb1 UTSW 12 16,699,532 (GRCm38) missense probably damaging 1.00
R2178:Greb1 UTSW 12 16,696,387 (GRCm38) missense probably damaging 1.00
R2194:Greb1 UTSW 12 16,690,908 (GRCm38) missense probably benign 0.08
R2248:Greb1 UTSW 12 16,680,378 (GRCm38) missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16,714,953 (GRCm38) missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16,724,922 (GRCm38) missense probably damaging 1.00
R2860:Greb1 UTSW 12 16,711,745 (GRCm38) missense probably benign 0.28
R2861:Greb1 UTSW 12 16,711,745 (GRCm38) missense probably benign 0.28
R2862:Greb1 UTSW 12 16,711,745 (GRCm38) missense probably benign 0.28
R2866:Greb1 UTSW 12 16,699,550 (GRCm38) missense probably damaging 1.00
R2890:Greb1 UTSW 12 16,704,478 (GRCm38) missense probably damaging 1.00
R3056:Greb1 UTSW 12 16,688,591 (GRCm38) missense probably damaging 0.96
R3863:Greb1 UTSW 12 16,702,420 (GRCm38) missense probably damaging 1.00
R3864:Greb1 UTSW 12 16,702,420 (GRCm38) missense probably damaging 1.00
R3956:Greb1 UTSW 12 16,682,299 (GRCm38) missense probably damaging 1.00
R4493:Greb1 UTSW 12 16,698,610 (GRCm38) missense probably benign 0.14
R4548:Greb1 UTSW 12 16,699,675 (GRCm38) missense probably damaging 1.00
R4683:Greb1 UTSW 12 16,711,773 (GRCm38) missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16,696,328 (GRCm38) missense probably damaging 1.00
R4770:Greb1 UTSW 12 16,681,356 (GRCm38) missense probably benign 0.03
R4838:Greb1 UTSW 12 16,684,360 (GRCm38) critical splice donor site probably null
R4925:Greb1 UTSW 12 16,681,471 (GRCm38) missense probably damaging 1.00
R4982:Greb1 UTSW 12 16,724,761 (GRCm38) missense probably damaging 0.98
R5009:Greb1 UTSW 12 16,724,857 (GRCm38) missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16,708,022 (GRCm38) intron probably benign
R5213:Greb1 UTSW 12 16,714,790 (GRCm38) nonsense probably null
R5310:Greb1 UTSW 12 16,716,759 (GRCm38) missense probably benign 0.09
R5353:Greb1 UTSW 12 16,688,566 (GRCm38) nonsense probably null
R5544:Greb1 UTSW 12 16,673,796 (GRCm38) missense probably damaging 1.00
R5605:Greb1 UTSW 12 16,708,726 (GRCm38) missense probably damaging 0.96
R5708:Greb1 UTSW 12 16,673,842 (GRCm38) missense probably benign 0.11
R5837:Greb1 UTSW 12 16,688,585 (GRCm38) missense probably damaging 1.00
R5890:Greb1 UTSW 12 16,733,421 (GRCm38) missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16,717,258 (GRCm38) missense probably damaging 1.00
R6049:Greb1 UTSW 12 16,681,394 (GRCm38) missense probably damaging 0.99
R6093:Greb1 UTSW 12 16,684,486 (GRCm38) missense probably benign
R6120:Greb1 UTSW 12 16,708,621 (GRCm38) missense probably damaging 0.99
R6175:Greb1 UTSW 12 16,674,770 (GRCm38) missense probably damaging 1.00
R6247:Greb1 UTSW 12 16,716,675 (GRCm38) missense probably damaging 1.00
R6274:Greb1 UTSW 12 16,735,151 (GRCm38) missense probably damaging 0.97
R6376:Greb1 UTSW 12 16,699,579 (GRCm38) missense probably damaging 0.97
R6523:Greb1 UTSW 12 16,684,373 (GRCm38) missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16,710,383 (GRCm38) missense probably benign 0.00
R6602:Greb1 UTSW 12 16,709,440 (GRCm38) missense probably benign 0.44
R6621:Greb1 UTSW 12 16,692,717 (GRCm38) missense probably damaging 1.00
R6645:Greb1 UTSW 12 16,698,579 (GRCm38) missense probably benign 0.07
R6725:Greb1 UTSW 12 16,688,567 (GRCm38) missense probably damaging 1.00
R6750:Greb1 UTSW 12 16,688,583 (GRCm38) missense probably benign 0.05
R6863:Greb1 UTSW 12 16,684,420 (GRCm38) missense probably damaging 1.00
R6914:Greb1 UTSW 12 16,707,902 (GRCm38) missense probably damaging 0.97
R6996:Greb1 UTSW 12 16,723,354 (GRCm38) missense probably benign 0.00
R7083:Greb1 UTSW 12 16,723,314 (GRCm38) missense probably benign
R7147:Greb1 UTSW 12 16,733,427 (GRCm38) missense probably damaging 1.00
R7238:Greb1 UTSW 12 16,674,672 (GRCm38) missense probably damaging 0.99
R7290:Greb1 UTSW 12 16,711,738 (GRCm38) missense probably damaging 1.00
R7358:Greb1 UTSW 12 16,724,881 (GRCm38) missense probably damaging 1.00
R7395:Greb1 UTSW 12 16,709,430 (GRCm38) critical splice donor site probably null
R7526:Greb1 UTSW 12 16,716,765 (GRCm38) missense probably benign 0.00
R7530:Greb1 UTSW 12 16,717,206 (GRCm38) missense probably benign 0.02
R7536:Greb1 UTSW 12 16,682,185 (GRCm38) missense probably damaging 1.00
R7643:Greb1 UTSW 12 16,711,996 (GRCm38) missense probably damaging 0.99
R7732:Greb1 UTSW 12 16,673,863 (GRCm38) missense probably damaging 1.00
R7740:Greb1 UTSW 12 16,740,121 (GRCm38) start gained probably benign
R7747:Greb1 UTSW 12 16,674,795 (GRCm38) missense probably benign 0.01
R7760:Greb1 UTSW 12 16,723,416 (GRCm38) missense probably benign
R7937:Greb1 UTSW 12 16,716,669 (GRCm38) missense probably damaging 0.99
R8043:Greb1 UTSW 12 16,711,789 (GRCm38) missense probably damaging 1.00
R8259:Greb1 UTSW 12 16,724,924 (GRCm38) nonsense probably null
R8553:Greb1 UTSW 12 16,723,327 (GRCm38) missense probably benign 0.00
R8559:Greb1 UTSW 12 16,696,435 (GRCm38) missense probably damaging 1.00
R8690:Greb1 UTSW 12 16,696,547 (GRCm38) missense probably benign 0.03
R8830:Greb1 UTSW 12 16,688,519 (GRCm38) missense probably benign 0.35
R8911:Greb1 UTSW 12 16,690,902 (GRCm38) missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16,724,884 (GRCm38) missense probably damaging 1.00
R8986:Greb1 UTSW 12 16,684,456 (GRCm38) missense probably damaging 0.99
R9013:Greb1 UTSW 12 16,739,969 (GRCm38) missense probably damaging 1.00
R9279:Greb1 UTSW 12 16,682,152 (GRCm38) missense probably damaging 0.99
R9360:Greb1 UTSW 12 16,740,036 (GRCm38) missense probably damaging 1.00
R9563:Greb1 UTSW 12 16,724,823 (GRCm38) missense probably benign 0.06
R9616:Greb1 UTSW 12 16,740,037 (GRCm38) missense probably damaging 1.00
R9627:Greb1 UTSW 12 16,706,166 (GRCm38) missense probably damaging 1.00
R9731:Greb1 UTSW 12 16,688,597 (GRCm38) missense probably damaging 1.00
R9761:Greb1 UTSW 12 16,701,274 (GRCm38) missense probably benign 0.05
Z1176:Greb1 UTSW 12 16,696,756 (GRCm38) missense probably benign 0.00
Z1177:Greb1 UTSW 12 16,702,491 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATTCCACAAGCAGAGAGCTG -3'
(R):5'- TGGGCACATTCTGAGAAGTCACAC -3'

Sequencing Primer
(F):5'- AACAGCCTTCCCGAGTCTTTG -3'
(R):5'- tccaatcacaatgctctctctc -3'
Posted On 2014-01-05