Incidental Mutation 'R1055:Nptxr'
ID94309
Institutional Source Beutler Lab
Gene Symbol Nptxr
Ensembl Gene ENSMUSG00000022421
Gene Nameneuronal pentraxin receptor
SynonymsNPR, D15Bwg0580e, 5730406O18Rik, 1700036C17Rik, NPCD
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1055 (G1)
Quality Score151
Status Validated
Chromosome15
Chromosomal Location79786351-79804766 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 79790255 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023057] [ENSMUST00000023060] [ENSMUST00000089299] [ENSMUST00000175858]
Predicted Effect probably benign
Transcript: ENSMUST00000023057
SMART Domains Protein: ENSMUSP00000023057
Gene: ENSMUSG00000022421

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 43 53 N/A INTRINSIC
low complexity region 57 71 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
PTX 281 487 2.17e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023060
SMART Domains Protein: ENSMUSP00000023060
Gene: ENSMUSG00000089837

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
PTX 160 366 2.17e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089299
SMART Domains Protein: ENSMUSP00000086714
Gene: ENSMUSG00000089837

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
low complexity region 98 115 N/A INTRINSIC
PTX 257 463 2.17e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125283
Predicted Effect probably benign
Transcript: ENSMUST00000175858
SMART Domains Protein: ENSMUSP00000135855
Gene: ENSMUSG00000022421

DomainStartEndE-ValueType
CHROMO 10 62 1.46e-18 SMART
PTX 160 366 2.17e-97 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a protein similar to the rat neuronal pentraxin receptor. The rat pentraxin receptor is an integral membrane protein that is thought to mediate neuronal uptake of the snake venom toxin, taipoxin, and its transport into the synapses. Studies in rat indicate that translation of this mRNA initiates at a non-AUG (CUG) codon. This may also be true for mouse and human, based on strong sequence conservation amongst these species. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation of this gene display a mild alteration in retinal ganglion cell innervation but are fertile with no obvious behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Nptxr
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0180:Nptxr UTSW 15 79794403 missense probably benign 0.09
R0208:Nptxr UTSW 15 79789715 missense probably null 1.00
R1487:Nptxr UTSW 15 79789903 missense probably damaging 1.00
R4820:Nptxr UTSW 15 79792826 missense probably damaging 1.00
R5948:Nptxr UTSW 15 79789841 missense probably benign 0.42
R6357:Nptxr UTSW 15 79794315 missense possibly damaging 0.78
X0017:Nptxr UTSW 15 79789842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAAGCCTGGTTCCCAAGGTTC -3'
(R):5'- GCAACTGGCACCATATCTGCATCTC -3'

Sequencing Primer
(F):5'- GGTTCCCAAGGTTCTAGCCC -3'
(R):5'- TCTCCTGGACTACAAGGGATG -3'
Posted On2014-01-05