Incidental Mutation 'R1055:Tmprss2'
ID94315
Institutional Source Beutler Lab
Gene Symbol Tmprss2
Ensembl Gene ENSMUSG00000000385
Gene Nametransmembrane protease, serine 2
Synonymsepitheliasin, D16Ertd61e
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97564682-97611195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97576262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 212 (N212D)
Ref Sequence ENSEMBL: ENSMUSP00000000395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000395] [ENSMUST00000231544]
Predicted Effect probably damaging
Transcript: ENSMUST00000000395
AA Change: N212D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000395
Gene: ENSMUSG00000000385
AA Change: N212D

DomainStartEndE-ValueType
transmembrane domain 86 108 N/A INTRINSIC
LDLa 111 149 1e-9 SMART
SR 148 241 8.55e-10 SMART
Tryp_SPc 253 482 4.58e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231908
Meta Mutation Damage Score 0.1917 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Gpank1 T A 17: 35,124,308 S255T probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Tmprss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Tmprss2 APN 16 97578595 nonsense probably null
IGL02130:Tmprss2 APN 16 97590889 missense probably damaging 1.00
IGL02149:Tmprss2 APN 16 97599279 utr 5 prime probably benign
IGL03080:Tmprss2 APN 16 97596844 missense probably damaging 0.98
PIT4480001:Tmprss2 UTSW 16 97599260 missense possibly damaging 0.77
R0395:Tmprss2 UTSW 16 97567045 missense probably damaging 1.00
R0485:Tmprss2 UTSW 16 97571994 unclassified probably benign
R1080:Tmprss2 UTSW 16 97591498 missense probably benign
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1930:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1931:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1955:Tmprss2 UTSW 16 97567177 critical splice acceptor site probably null
R2443:Tmprss2 UTSW 16 97568503 missense possibly damaging 0.65
R3825:Tmprss2 UTSW 16 97596821 missense probably damaging 1.00
R4508:Tmprss2 UTSW 16 97570427 missense probably damaging 1.00
R5212:Tmprss2 UTSW 16 97576292 missense probably benign 0.00
R5571:Tmprss2 UTSW 16 97590871 missense probably null 1.00
R5715:Tmprss2 UTSW 16 97568983 missense possibly damaging 0.65
R6816:Tmprss2 UTSW 16 97568467 missense possibly damaging 0.94
R6921:Tmprss2 UTSW 16 97568437 missense probably damaging 0.98
R7230:Tmprss2 UTSW 16 97578597 missense probably benign 0.02
R7311:Tmprss2 UTSW 16 97568416 missense possibly damaging 0.94
R7788:Tmprss2 UTSW 16 97576229 nonsense probably null
R8052:Tmprss2 UTSW 16 97568416 missense not run
Z1176:Tmprss2 UTSW 16 97567057 missense not run
Predicted Primers PCR Primer
(F):5'- TGTGAAACACTGCTTACCTCCACC -3'
(R):5'- GCTGATGGGAGACTCTAACCTTGC -3'

Sequencing Primer
(F):5'- TGCTTACCTCCACCCAAAACAG -3'
(R):5'- TGGACAATGGTTTTCAGACAGC -3'
Posted On2014-01-05