Incidental Mutation 'R1055:Gpank1'
ID94318
Institutional Source Beutler Lab
Gene Symbol Gpank1
Ensembl Gene ENSMUSG00000092417
Gene NameG patch domain and ankyrin repeats 1
SynonymsG5, Bat4, D17H6S54E
MMRRC Submission 039145-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1055 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35121455-35124814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35124308 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 255 (S255T)
Ref Sequence ENSEMBL: ENSMUSP00000056646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025246] [ENSMUST00000025249] [ENSMUST00000052167] [ENSMUST00000061859] [ENSMUST00000165306] [ENSMUST00000172765] [ENSMUST00000173043] [ENSMUST00000173114] [ENSMUST00000173380] [ENSMUST00000173915] [ENSMUST00000174024] [ENSMUST00000174306] [ENSMUST00000174779]
Predicted Effect probably benign
Transcript: ENSMUST00000025246
SMART Domains Protein: ENSMUSP00000025246
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025249
SMART Domains Protein: ENSMUSP00000025249
Gene: ENSMUSG00000024391

DomainStartEndE-ValueType
Pfam:ApoM 1 189 9.2e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052167
AA Change: S255T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056646
Gene: ENSMUSG00000092417
AA Change: S255T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 82 99 N/A INTRINSIC
ANK 156 186 4.36e-1 SMART
G_patch 269 315 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061859
SMART Domains Protein: ENSMUSP00000061264
Gene: ENSMUSG00000043311

DomainStartEndE-ValueType
Pfam:DUF4661 16 264 8.3e-141 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165306
AA Change: S232T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133240
Gene: ENSMUSG00000092417
AA Change: S232T

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 4.36e-1 SMART
G_patch 246 292 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172765
SMART Domains Protein: ENSMUSP00000134523
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 29 206 6.86e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173043
SMART Domains Protein: ENSMUSP00000135684
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 2.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173114
SMART Domains Protein: ENSMUSP00000134218
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173380
SMART Domains Protein: ENSMUSP00000134694
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173576
Predicted Effect probably benign
Transcript: ENSMUST00000173915
SMART Domains Protein: ENSMUSP00000133425
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 58 6.45e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174024
SMART Domains Protein: ENSMUSP00000134673
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 169 5.07e-71 SMART
Blast:CK_II_beta 189 220 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174306
SMART Domains Protein: ENSMUSP00000134413
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 122 3.01e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174311
Predicted Effect probably benign
Transcript: ENSMUST00000174779
SMART Domains Protein: ENSMUSP00000133684
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 1 140 2.47e-83 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177018
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 95.3%
  • 20x: 87.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located in a cluster of HLA-B-associated transcripts, which is included in the human major histocompatability complex III region. This gene encodes a protein which is thought to play a role in immunity. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A G 14: 63,973,275 V168A possibly damaging Het
A1cf C A 19: 31,932,519 T237N probably benign Het
Actl10 A T 2: 154,552,668 Q180L probably benign Het
Adcy1 T C 11: 7,109,075 L327P probably damaging Het
Adcy7 T C 8: 88,318,057 probably benign Het
Ahctf1 G A 1: 179,763,486 T1243I possibly damaging Het
Akap6 C T 12: 52,880,672 Q122* probably null Het
Apob G A 12: 7,994,963 G861D probably damaging Het
Arhgef11 A C 3: 87,717,118 T539P probably benign Het
Cd244 T A 1: 171,577,276 V232E probably damaging Het
Chia1 A C 3: 106,130,883 D365A probably damaging Het
Clpsl2 C T 17: 28,549,526 Q5* probably null Het
Clrn1 T A 3: 58,865,110 I117F probably benign Het
Csmd3 A G 15: 47,881,537 L1354P probably damaging Het
Csn2 G A 5: 87,694,737 P144S possibly damaging Het
D17Wsu92e T C 17: 27,767,936 N272S probably damaging Het
Dcdc2a T A 13: 25,102,610 M172K probably damaging Het
Dnah9 A T 11: 66,160,011 W152R probably damaging Het
Dnmt3a T A 12: 3,872,864 S82T probably benign Het
Ebf1 A G 11: 44,632,775 K146E probably damaging Het
Gfpt2 A C 11: 49,827,211 R504S probably damaging Het
Greb1 T C 12: 16,682,251 M1570V probably damaging Het
Gtf2i A T 5: 134,263,624 I403K probably damaging Het
Hoxc11 T A 15: 102,954,835 C104S probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Khdrbs2 A T 1: 32,644,157 probably benign Het
Lix1l G T 3: 96,621,310 G200V probably damaging Het
Lrrc23 T C 6: 124,778,151 N141S probably damaging Het
March11 A T 15: 26,309,662 D134V probably damaging Het
Myo9a A T 9: 59,855,370 T795S probably benign Het
Nhsl1 T A 10: 18,525,475 D782E probably benign Het
Nptxr T C 15: 79,790,255 probably benign Het
Nrp1 A G 8: 128,468,598 M512V possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1126 ATTGCTACTC A 2: 87,457,437 probably benign Het
Olfr1469 G A 19: 13,411,390 A274T probably benign Het
Pard3 T C 8: 127,378,280 F267S probably benign Het
Pomt2 G A 12: 87,147,480 T50M possibly damaging Het
Qsox2 A G 2: 26,214,125 Y298H probably damaging Het
Rabgap1 A G 2: 37,492,068 K450E possibly damaging Het
Rpa1 A T 11: 75,302,732 V591D probably damaging Het
Sall3 A C 18: 80,969,792 M1143R probably benign Het
Scgb1b19 G T 7: 33,287,343 A13S unknown Het
Scn1a T C 2: 66,337,996 T89A probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sdr42e1 T G 8: 117,663,584 N106T probably damaging Het
Shpk A T 11: 73,215,119 M266L probably benign Het
Slc34a1 G T 13: 55,403,033 R139L probably benign Het
Smbd1 C A 16: 32,806,718 D67Y probably damaging Het
Srd5a3 A G 5: 76,153,638 N238S probably benign Het
Tmprss2 T C 16: 97,576,262 N212D probably damaging Het
Uap1 G T 1: 170,156,911 probably benign Het
Ugt1a6a A G 1: 88,139,014 M181V probably benign Het
Vmn2r32 C T 7: 7,474,327 W355* probably null Het
Vmn2r86 T A 10: 130,446,357 S797C probably damaging Het
Wiz A G 17: 32,387,642 S40P probably damaging Het
Zfand6 A G 7: 84,615,973 probably benign Het
Zfp280d G A 9: 72,329,167 probably null Het
Other mutations in Gpank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0515:Gpank1 UTSW 17 35123499 missense probably damaging 1.00
R2850:Gpank1 UTSW 17 35124581 missense probably benign 0.21
R4274:Gpank1 UTSW 17 35124269 missense probably benign 0.22
R5716:Gpank1 UTSW 17 35123253 missense probably damaging 0.97
R6285:Gpank1 UTSW 17 35124290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCTGACATTGGGAGAAAGGC -3'
(R):5'- AGTCCAAGTGTCCAAGTCAGAGGC -3'

Sequencing Primer
(F):5'- AGTACTTTGCTCTGCTCTGC -3'
(R):5'- TGACTCAGTGTGGCAACTC -3'
Posted On2014-01-05