Incidental Mutation 'R1056:Prdm13'
ID94344
Institutional Source Beutler Lab
Gene Symbol Prdm13
Ensembl Gene ENSMUSG00000040478
Gene NamePR domain containing 13
Synonyms
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1056 (G1)
Quality Score196
Status Not validated
Chromosome4
Chromosomal Location21677480-21685963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21678544 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 649 (K649E)
Ref Sequence ENSEMBL: ENSMUSP00000092761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076206] [ENSMUST00000095141]
Predicted Effect probably damaging
Transcript: ENSMUST00000076206
AA Change: K601E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075562
Gene: ENSMUSG00000040478
AA Change: K601E

DomainStartEndE-ValueType
Blast:SET 2 118 4e-72 BLAST
PDB:3EP0|B 56 132 1e-8 PDB
ZnF_C2H2 137 159 3.34e-2 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 231 252 N/A INTRINSIC
low complexity region 267 275 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 353 370 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 546 571 N/A INTRINSIC
ZnF_C2H2 572 594 4.4e-2 SMART
ZnF_C2H2 600 622 1.92e-2 SMART
ZnF_C2H2 629 652 2.79e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095141
AA Change: K649E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092761
Gene: ENSMUSG00000040478
AA Change: K649E

DomainStartEndE-ValueType
Blast:SET 42 166 1e-73 BLAST
PDB:3EP0|B 104 180 1e-8 PDB
ZnF_C2H2 185 207 3.34e-2 SMART
low complexity region 252 268 N/A INTRINSIC
low complexity region 279 300 N/A INTRINSIC
low complexity region 315 323 N/A INTRINSIC
low complexity region 350 383 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 440 452 N/A INTRINSIC
low complexity region 594 619 N/A INTRINSIC
ZnF_C2H2 620 642 4.4e-2 SMART
ZnF_C2H2 648 670 1.92e-2 SMART
ZnF_C2H2 677 700 2.79e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149516
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show a specific reduction in the number of GABAergic and glycinergic amacrine cells, a thin retinal inner nuclear layer, altered retinal inner plexiform layer morphology, and abnormally increased spatial, temporal, and contrast sensitivities in optokinetic reponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Prdm13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02940:Prdm13 APN 4 21683421 nonsense probably null
IGL03211:Prdm13 APN 4 21678492 missense probably damaging 1.00
R0363:Prdm13 UTSW 4 21679737 missense unknown
R0512:Prdm13 UTSW 4 21678490 missense probably damaging 1.00
R0726:Prdm13 UTSW 4 21683914 missense unknown
R1433:Prdm13 UTSW 4 21678909 missense probably damaging 1.00
R2005:Prdm13 UTSW 4 21685695 utr 5 prime probably benign
R2292:Prdm13 UTSW 4 21683914 missense unknown
R2382:Prdm13 UTSW 4 21678277 missense possibly damaging 0.73
R3620:Prdm13 UTSW 4 21683532 missense unknown
R4039:Prdm13 UTSW 4 21685774 utr 5 prime probably benign
R4417:Prdm13 UTSW 4 21678756 missense probably benign 0.39
R4453:Prdm13 UTSW 4 21679464 missense unknown
R4850:Prdm13 UTSW 4 21678243 missense possibly damaging 0.92
R4864:Prdm13 UTSW 4 21685543 missense unknown
R4934:Prdm13 UTSW 4 21678223 utr 3 prime probably benign
R5138:Prdm13 UTSW 4 21679507 missense unknown
R5304:Prdm13 UTSW 4 21678984 missense probably damaging 1.00
R5394:Prdm13 UTSW 4 21679455 missense unknown
R5909:Prdm13 UTSW 4 21683894 missense unknown
R5964:Prdm13 UTSW 4 21683852 nonsense probably null
R6261:Prdm13 UTSW 4 21678366 missense probably damaging 1.00
R7166:Prdm13 UTSW 4 21683528 missense unknown
R7175:Prdm13 UTSW 4 21679473 missense unknown
R7549:Prdm13 UTSW 4 21679072 missense probably damaging 1.00
Z1176:Prdm13 UTSW 4 21679518 missense unknown
Z1177:Prdm13 UTSW 4 21679623 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTCAGTGAAGCAGACATCCACATC -3'
(R):5'- TGCTCAAATACCCCGAGTCCATCTC -3'

Sequencing Primer
(F):5'- TCCAGAGCATAGCTGGGC -3'
(R):5'- GAGTCCATCTCCTATCTGAGTG -3'
Posted On2014-01-05