Mutagenetix > Incidental Mutation

Incidental Mutation 'R1056:Nfx1'

94346

Institutional Source

Beutler Lab

Gene Symbol

Nfx1

Ensembl Gene

ENSMUSG00000028423

Gene Name

nuclear transcription factor, X-box binding 1

Synonyms

1300017N15Rik, Tex42, 3000003M19Rik, TEG-42

MMRRC Submission

039146-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R1056 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40970906-41025993 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41003057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 686 (R686Q)

Ref Sequence

ENSEMBL: ENSMUSP00000095747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]

AlphaFold

B1AY10

Predicted Effect

probably damaging
Transcript: ENSMUST00000030133
AA Change: R686Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: R686Q

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091614
AA Change: R686Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: R686Q

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098143
AA Change: R686Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: R686Q

Domain	Start	End	E-Value	Type
RING	352	402	3.91e-2	SMART
ZnF_NFX	447	465	1.23e-3	SMART
ZnF_NFX	500	519	6.16e-4	SMART
ZnF_NFX	561	580	2e-3	SMART
ZnF_NFX	626	649	5.45e-5	SMART
ZnF_NFX	688	707	5.25e0	SMART
ZnF_NFX	715	734	2.92e-5	SMART
ZnF_NFX	772	791	5.25e0	SMART
ZnF_NFX	826	848	7.7e-5	SMART
ZnF_NFX	857	878	4.23e-2	SMART
coiled coil region	930	956	N/A	INTRINSIC
R3H	977	1055	1.38e-22	SMART
low complexity region	1070	1088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143798

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	A	3: 36,983,453	H2469N	possibly damaging	Het
4932438A13Rik	T	A	3: 37,044,680	M1152K	probably benign	Het
Abca14	A	G	7: 120,325,072	Y1649C	probably damaging	Het
Abcc10	A	C	17: 46,303,954	C1459W	possibly damaging	Het
Amfr	A	T	8: 93,985,469	F278I	probably benign	Het
Anks1b	G	T	10: 90,921,429		probably null	Het
Bak1	A	G	17: 27,021,273	S147P	possibly damaging	Het
C7	T	C	15: 5,045,778	N144S	possibly damaging	Het
Casd1	T	C	6: 4,641,967	V748A	probably benign	Het
Ccdc180	T	C	4: 45,916,375	S859P	probably benign	Het
Ccne2	T	C	4: 11,192,707	S2P	probably damaging	Het
Cdc42bpg	T	A	19: 6,314,021	I541N	probably benign	Het
Cgnl1	T	A	9: 71,725,895	N58I	probably damaging	Het
Chd7	T	C	4: 8,822,402	S832P	possibly damaging	Het
Chl1	A	T	6: 103,675,077	Y318F	possibly damaging	Het
Coq2	G	T	5: 100,657,947	N274K	probably benign	Het
Crhr2	A	T	6: 55,100,735	V214E	probably damaging	Het
Dgkg	G	C	16: 22,600,541	P70A	probably damaging	Het
Dync2h1	T	C	9: 7,147,731	I966M	probably benign	Het
Eif5b	C	G	1: 38,022,167	R380G	unknown	Het
Fat4	T	A	3: 38,891,392	I1478N	probably damaging	Het
Gm8251	C	T	1: 44,060,927	G337D	probably damaging	Het
Impact	A	T	18: 12,976,524	I92L	probably benign	Het
Ly6c2	A	G	15: 75,111,596		probably null	Het
Lypd6b	G	A	2: 49,947,456	V147I	possibly damaging	Het
Mdga2	T	C	12: 66,723,120	D192G	probably damaging	Het
Mms22l	T	C	4: 24,586,344		probably null	Het
Myo9a	C	T	9: 59,832,201	T732I	possibly damaging	Het
Myrf	C	T	19: 10,223,486	M274I	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr43	C	T	11: 74,206,782	V145I	probably benign	Het
Olfr594	A	T	7: 103,220,418	E233D	probably benign	Het
Oog4	T	C	4: 143,438,011	T245A	possibly damaging	Het
Pclo	A	T	5: 14,540,055	K790*	probably null	Het
Pcm1	A	G	8: 41,321,900	E1668G	probably damaging	Het
Pkhd1l1	T	A	15: 44,591,964	N4040K	probably damaging	Het
Podnl1	T	A	8: 84,129,276	S222T	probably benign	Het
Ppil4	A	G	10: 7,799,632	T182A	possibly damaging	Het
Prdm13	T	C	4: 21,678,544	K649E	probably damaging	Het
Prob1	A	T	18: 35,653,610	H530Q	probably benign	Het
Rbbp4	A	T	4: 129,317,649	M404K	probably damaging	Het
Rilpl1	A	T	5: 124,493,837	F149I	probably damaging	Het
Sema6c	T	A	3: 95,171,216	S543T	probably benign	Het
Sh3rf3	G	T	10: 59,007,082	W290L	probably damaging	Het
Slc2a12	T	G	10: 22,665,451	S402A	probably benign	Het
Tas2r131	T	A	6: 132,957,067	I260F	possibly damaging	Het
Tasp1	A	G	2: 140,008,764	I113T	possibly damaging	Het
Tnrc18	G	A	5: 142,773,859	R741*	probably null	Het
Ube2o	G	T	11: 116,546,464	D244E	probably damaging	Het
Vmn1r206	A	T	13: 22,620,614	M141K	probably benign	Het
Zbtb14	C	A	17: 69,388,502	F398L	probably damaging	Het
Zfp747	A	G	7: 127,374,588	S137P	probably benign	Het
Zfp951	A	T	5: 104,815,285	H138Q	possibly damaging	Het

Other mutations in Nfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Nfx1	APN	4	40977241	missense	probably benign	0.00
IGL01998:Nfx1	APN	4	41004353	missense	probably damaging	1.00
IGL02072:Nfx1	APN	4	41016119	missense	probably benign
IGL02170:Nfx1	APN	4	41018019	missense	probably damaging	1.00
IGL02188:Nfx1	APN	4	40993827	missense	probably damaging	1.00
IGL02502:Nfx1	APN	4	40976345	splice site	probably benign
IGL02674:Nfx1	APN	4	40999717	critical splice donor site	probably null
IGL03007:Nfx1	APN	4	40984962	missense	probably benign	0.02
IGL03092:Nfx1	APN	4	41024851	missense	probably damaging	1.00
IGL03303:Nfx1	APN	4	41004323	splice site	probably benign
K7371:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
PIT4498001:Nfx1	UTSW	4	40977244	missense	probably benign
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0032:Nfx1	UTSW	4	41015321	missense	probably benign	0.00
R0069:Nfx1	UTSW	4	40986688	splice site	probably benign
R1449:Nfx1	UTSW	4	40976803	missense	probably damaging	1.00
R1635:Nfx1	UTSW	4	40977004	missense	probably benign
R1636:Nfx1	UTSW	4	41016072	splice site	probably null
R1882:Nfx1	UTSW	4	41009240	missense	possibly damaging	0.55
R2089:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R2091:Nfx1	UTSW	4	40977004	missense	probably benign
R3792:Nfx1	UTSW	4	41004357	nonsense	probably null
R3793:Nfx1	UTSW	4	41004357	nonsense	probably null
R4668:Nfx1	UTSW	4	40976367	missense	possibly damaging	0.50
R4678:Nfx1	UTSW	4	41012070	missense	probably benign	0.01
R4894:Nfx1	UTSW	4	40996877	missense	probably damaging	1.00
R4972:Nfx1	UTSW	4	40976375	missense	probably benign	0.36
R5066:Nfx1	UTSW	4	40991868	missense	probably benign
R5389:Nfx1	UTSW	4	40985000	missense	probably damaging	1.00
R5429:Nfx1	UTSW	4	41004343	missense	probably damaging	1.00
R5643:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5644:Nfx1	UTSW	4	40984973	missense	probably null	1.00
R5915:Nfx1	UTSW	4	40977285	missense	probably benign	0.02
R6286:Nfx1	UTSW	4	40986728	missense	probably damaging	1.00
R6393:Nfx1	UTSW	4	40976851	missense	possibly damaging	0.92
R7409:Nfx1	UTSW	4	41021830	missense	possibly damaging	0.64
R7523:Nfx1	UTSW	4	41016119	missense	probably benign
R7916:Nfx1	UTSW	4	40977142	missense	probably benign	0.11
R8497:Nfx1	UTSW	4	40976968	missense	possibly damaging	0.67
R8799:Nfx1	UTSW	4	41023727	missense	probably damaging	1.00
R9154:Nfx1	UTSW	4	40990845	missense	probably damaging	1.00
R9364:Nfx1	UTSW	4	41023756	missense	probably benign	0.31
R9497:Nfx1	UTSW	4	40994104	missense	probably benign	0.00
X0025:Nfx1	UTSW	4	40976422	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTGAGCAGGCTGCATAGGCAAC -3'
(R):5'- TATGTGAGCTGCCATCGTGGAGAG -3'

Sequencing Primer
(F):5'- ATAGGCAACCTGGTGCTTC -3'
(R):5'- AAGGCCATGTCTGCTCAATG -3'

Posted On

2014-01-05