Incidental Mutation 'R1056:Mdga2'
ID 94395
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1056 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 66466060-67222549 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66723120 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: D202G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: D202G

IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177690
Predicted Effect probably damaging
Transcript: ENSMUST00000178814
AA Change: D192G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: D192G

signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: D133G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: D133G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
R8715:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66797635 missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66568889 missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66470707 missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66568860 missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66689452 missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66513283 missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66550530 missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66568758 missense probably benign 0.44
R9633:Mdga2 UTSW 12 66689432 missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66568953 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttcccttcaaactttcccatataac -3'
Posted On 2014-01-05