Incidental Mutation 'R1056:Mdga2'
ID 94395
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms 6720489L24Rik, Mdga2, Adp, 9330209L04Rik, Mamdc1
MMRRC Submission 039146-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1056 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 66512834-67269323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66769894 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: D202G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: D202G

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177690
Predicted Effect probably damaging
Transcript: ENSMUST00000178814
AA Change: D192G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: D192G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: D133G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: D133G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,924,295 (GRCm39) Y1649C probably damaging Het
Abcc10 A C 17: 46,614,880 (GRCm39) C1459W possibly damaging Het
Amfr A T 8: 94,712,097 (GRCm39) F278I probably benign Het
Anks1b G T 10: 90,757,291 (GRCm39) probably null Het
Bak1 A G 17: 27,240,247 (GRCm39) S147P possibly damaging Het
Bltp1 C A 3: 37,037,602 (GRCm39) H2469N possibly damaging Het
Bltp1 T A 3: 37,098,829 (GRCm39) M1152K probably benign Het
C7 T C 15: 5,075,260 (GRCm39) N144S possibly damaging Het
Casd1 T C 6: 4,641,967 (GRCm39) V748A probably benign Het
Ccdc168 C T 1: 44,100,087 (GRCm39) G337D probably damaging Het
Ccdc180 T C 4: 45,916,375 (GRCm39) S859P probably benign Het
Ccne2 T C 4: 11,192,707 (GRCm39) S2P probably damaging Het
Cdc42bpg T A 19: 6,364,051 (GRCm39) I541N probably benign Het
Cgnl1 T A 9: 71,633,177 (GRCm39) N58I probably damaging Het
Chd7 T C 4: 8,822,402 (GRCm39) S832P possibly damaging Het
Chl1 A T 6: 103,652,038 (GRCm39) Y318F possibly damaging Het
Coq2 G T 5: 100,805,813 (GRCm39) N274K probably benign Het
Crhr2 A T 6: 55,077,720 (GRCm39) V214E probably damaging Het
Dgkg G C 16: 22,419,291 (GRCm39) P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 (GRCm39) I966M probably benign Het
Eif5b C G 1: 38,061,248 (GRCm39) R380G unknown Het
Fat4 T A 3: 38,945,541 (GRCm39) I1478N probably damaging Het
Impact A T 18: 13,109,581 (GRCm39) I92L probably benign Het
Ly6c2 A G 15: 74,983,445 (GRCm39) probably null Het
Lypd6b G A 2: 49,837,468 (GRCm39) V147I possibly damaging Het
Mms22l T C 4: 24,586,344 (GRCm39) probably null Het
Myo9a C T 9: 59,739,484 (GRCm39) T732I possibly damaging Het
Myrf C T 19: 10,200,850 (GRCm39) M274I probably benign Het
Nfx1 G A 4: 41,003,057 (GRCm39) R686Q probably damaging Het
Ofcc1 C T 13: 40,362,305 (GRCm39) G206R probably benign Het
Oog4 T C 4: 143,164,581 (GRCm39) T245A possibly damaging Het
Or1a1b C T 11: 74,097,608 (GRCm39) V145I probably benign Het
Or52e3 A T 7: 102,869,625 (GRCm39) E233D probably benign Het
Pclo A T 5: 14,590,069 (GRCm39) K790* probably null Het
Pcm1 A G 8: 41,774,937 (GRCm39) E1668G probably damaging Het
Pkhd1l1 T A 15: 44,455,360 (GRCm39) N4040K probably damaging Het
Podnl1 T A 8: 84,855,905 (GRCm39) S222T probably benign Het
Ppil4 A G 10: 7,675,396 (GRCm39) T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 (GRCm39) K649E probably damaging Het
Prob1 A T 18: 35,786,663 (GRCm39) H530Q probably benign Het
Rbbp4 A T 4: 129,211,442 (GRCm39) M404K probably damaging Het
Rilpl1 A T 5: 124,631,900 (GRCm39) F149I probably damaging Het
Sema6c T A 3: 95,078,527 (GRCm39) S543T probably benign Het
Sh3rf3 G T 10: 58,842,904 (GRCm39) W290L probably damaging Het
Slc2a12 T G 10: 22,541,350 (GRCm39) S402A probably benign Het
Tas2r131 T A 6: 132,934,030 (GRCm39) I260F possibly damaging Het
Tasp1 A G 2: 139,850,684 (GRCm39) I113T possibly damaging Het
Tnrc18 G A 5: 142,759,614 (GRCm39) R741* probably null Het
Ube2o G T 11: 116,437,290 (GRCm39) D244E probably damaging Het
Vmn1r206 A T 13: 22,804,784 (GRCm39) M141K probably benign Het
Zbtb14 C A 17: 69,695,497 (GRCm39) F398L probably damaging Het
Zfp747 A G 7: 126,973,760 (GRCm39) S137P probably benign Het
Zfp951 A T 5: 104,963,151 (GRCm39) H138Q possibly damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66,769,883 (GRCm39) missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66,676,672 (GRCm39) splice site probably benign
IGL01843:Mdga2 APN 12 66,769,905 (GRCm39) critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66,702,197 (GRCm39) nonsense probably null
IGL02348:Mdga2 APN 12 66,597,349 (GRCm39) missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66,597,385 (GRCm39) missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66,736,206 (GRCm39) missense probably benign 0.00
IGL02901:Mdga2 APN 12 66,844,583 (GRCm39) splice site probably benign
IGL03373:Mdga2 APN 12 66,763,496 (GRCm39) missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66,844,542 (GRCm39) missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66,763,469 (GRCm39) missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66,763,480 (GRCm39) missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66,701,894 (GRCm39) missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66,517,700 (GRCm39) missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66,533,507 (GRCm39) missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66,769,854 (GRCm39) missense probably damaging 1.00
R1086:Mdga2 UTSW 12 66,552,876 (GRCm39) splice site probably benign
R1335:Mdga2 UTSW 12 66,763,516 (GRCm39) splice site probably null
R1382:Mdga2 UTSW 12 66,517,690 (GRCm39) missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66,844,530 (GRCm39) missense probably benign 0.01
R1521:Mdga2 UTSW 12 66,615,700 (GRCm39) missense probably benign 0.00
R1556:Mdga2 UTSW 12 66,597,367 (GRCm39) missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66,615,547 (GRCm39) nonsense probably null
R1676:Mdga2 UTSW 12 66,615,546 (GRCm39) missense probably damaging 1.00
R1698:Mdga2 UTSW 12 66,736,109 (GRCm39) missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66,533,482 (GRCm39) splice site probably benign
R2069:Mdga2 UTSW 12 66,615,691 (GRCm39) nonsense probably null
R2077:Mdga2 UTSW 12 66,702,136 (GRCm39) missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66,915,515 (GRCm39) missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66,736,155 (GRCm39) missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66,519,970 (GRCm39) splice site probably null
R2293:Mdga2 UTSW 12 66,615,759 (GRCm39) nonsense probably null
R2886:Mdga2 UTSW 12 66,553,044 (GRCm39) splice site probably benign
R2960:Mdga2 UTSW 12 66,676,752 (GRCm39) nonsense probably null
R3937:Mdga2 UTSW 12 67,267,980 (GRCm39) unclassified probably benign
R4437:Mdga2 UTSW 12 66,519,972 (GRCm39) splice site probably null
R4514:Mdga2 UTSW 12 66,763,496 (GRCm39) missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66,844,407 (GRCm39) missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66,517,775 (GRCm39) unclassified probably benign
R4744:Mdga2 UTSW 12 66,844,501 (GRCm39) missense probably benign 0.01
R4756:Mdga2 UTSW 12 66,844,427 (GRCm39) missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66,844,396 (GRCm39) splice site probably null
R5022:Mdga2 UTSW 12 66,517,534 (GRCm39) missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66,533,515 (GRCm39) missense probably benign 0.43
R5479:Mdga2 UTSW 12 66,701,950 (GRCm39) missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66,553,556 (GRCm39) missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66,701,956 (GRCm39) missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66,702,109 (GRCm39) missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66,844,537 (GRCm39) missense probably benign 0.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66,676,827 (GRCm39) missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66,553,027 (GRCm39) missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66,676,843 (GRCm39) missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66,769,775 (GRCm39) missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66,552,889 (GRCm39) missense probably benign 0.01
R6971:Mdga2 UTSW 12 66,597,335 (GRCm39) missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66,736,158 (GRCm39) missense probably benign 0.41
R7069:Mdga2 UTSW 12 66,533,526 (GRCm39) missense probably benign 0.31
R7381:Mdga2 UTSW 12 66,615,670 (GRCm39) missense probably benign 0.44
R7474:Mdga2 UTSW 12 66,533,535 (GRCm39) nonsense probably null
R7559:Mdga2 UTSW 12 66,520,003 (GRCm39) missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66,553,029 (GRCm39) missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66,552,897 (GRCm39) missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66,736,125 (GRCm39) missense possibly damaging 0.63
R7745:Mdga2 UTSW 12 66,736,124 (GRCm39) missense probably damaging 0.99
R7852:Mdga2 UTSW 12 66,517,724 (GRCm39) missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66,702,037 (GRCm39) missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67,267,803 (GRCm39) missense unknown
R8715:Mdga2 UTSW 12 66,915,526 (GRCm39) missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66,844,409 (GRCm39) missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66,615,663 (GRCm39) missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66,517,481 (GRCm39) missense possibly damaging 0.66
R9223:Mdga2 UTSW 12 66,615,634 (GRCm39) missense possibly damaging 0.81
R9248:Mdga2 UTSW 12 66,736,226 (GRCm39) missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66,560,057 (GRCm39) missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66,597,304 (GRCm39) missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66,615,532 (GRCm39) missense probably benign 0.44
R9633:Mdga2 UTSW 12 66,736,206 (GRCm39) missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66,736,217 (GRCm39) missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66,615,727 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAATCTCCACTCCCTTGTCAGATCCT -3'
(R):5'- TGGGCTCTGTGATACTGAATTCTGTAGT -3'

Sequencing Primer
(F):5'- AGATCCTTGTAGTAATACCTCCTGAC -3'
(R):5'- ttcccttcaaactttcccatataac -3'
Posted On 2014-01-05