Incidental Mutation 'R1056:Bak1'
ID94407
Institutional Source Beutler Lab
Gene Symbol Bak1
Ensembl Gene ENSMUSG00000057789
Gene NameBCL2-antagonist/killer 1
SynonymsN-Bak, Bak
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1056 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27019810-27029009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27021273 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 147 (S147P)
Ref Sequence ENSEMBL: ENSMUSP00000025034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025034] [ENSMUST00000078691] [ENSMUST00000122106] [ENSMUST00000133257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025034
AA Change: S147P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025034
Gene: ENSMUSG00000057789
AA Change: S147P

DomainStartEndE-ValueType
SCOP:d1f16a_ 15 114 2e-18 SMART
PDB:2M5B|A 18 126 1e-50 PDB
Blast:BCL 33 66 2e-10 BLAST
Blast:BCL 76 126 2e-20 BLAST
low complexity region 127 140 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078691
AA Change: V140A

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077757
Gene: ENSMUSG00000057789
AA Change: V140A

DomainStartEndE-ValueType
BCL 76 175 2.2e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122106
SMART Domains Protein: ENSMUSP00000113880
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Ubiquitin_3 172 260 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133448
SMART Domains Protein: ENSMUSP00000122800
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142141
Predicted Effect probably benign
Transcript: ENSMUST00000143158
SMART Domains Protein: ENSMUSP00000122521
Gene: ENSMUSG00000057789

DomainStartEndE-ValueType
PDB:2YV6|A 2 64 2e-29 PDB
SCOP:d1k3ka_ 6 75 4e-14 SMART
Blast:BCL 25 64 6e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151920
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Bak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02734:Bak1 APN 17 27020953 missense possibly damaging 0.62
R1806:Bak1 UTSW 17 27021268 nonsense probably null
R4135:Bak1 UTSW 17 27021270 missense possibly damaging 0.66
R4422:Bak1 UTSW 17 27021324 missense probably damaging 1.00
R4664:Bak1 UTSW 17 27022536 missense possibly damaging 0.81
R5182:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R5185:Bak1 UTSW 17 27022748 missense possibly damaging 0.86
R6469:Bak1 UTSW 17 27021319 missense probably damaging 1.00
R7155:Bak1 UTSW 17 27022460 missense possibly damaging 0.82
R7999:Bak1 UTSW 17 27021306 missense probably damaging 1.00
R8086:Bak1 UTSW 17 27020937 missense probably benign 0.21
X0066:Bak1 UTSW 17 27022569 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAAAATTCAGGGCTGCCACC -3'
(R):5'- AGCTTAGCCGTGTAGCTTCCCATC -3'

Sequencing Primer
(F):5'- AACAGGGTGGGTTATAGTGGC -3'
(R):5'- CCCATCTGGTGGTGGAGG -3'
Posted On2014-01-05