Incidental Mutation 'R1056:Prob1'
ID94412
Institutional Source Beutler Lab
Gene Symbol Prob1
Ensembl Gene ENSMUSG00000073600
Gene Nameproline rich basic protein 1
SynonymsLOC381148, Gm1614
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R1056 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35650351-35655238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35653610 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 530 (H530Q)
Ref Sequence ENSEMBL: ENSMUSP00000140465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025209] [ENSMUST00000025211] [ENSMUST00000097619] [ENSMUST00000190196]
Predicted Effect probably benign
Transcript: ENSMUST00000025209
SMART Domains Protein: ENSMUSP00000025209
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 10 191 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025211
SMART Domains Protein: ENSMUSP00000025211
Gene: ENSMUSG00000024353

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 48 177 5.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097619
AA Change: H526Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095224
Gene: ENSMUSG00000073600
AA Change: H526Q

DomainStartEndE-ValueType
low complexity region 78 102 N/A INTRINSIC
low complexity region 142 155 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 536 553 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
Pfam:DUF4585 862 931 4.6e-27 PFAM
low complexity region 989 1002 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186951
Predicted Effect probably benign
Transcript: ENSMUST00000190196
AA Change: H530Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140465
Gene: ENSMUSG00000073600
AA Change: H530Q

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
low complexity region 381 400 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 833 852 N/A INTRINSIC
Pfam:DUF4585 864 936 7.5e-27 PFAM
low complexity region 993 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Prob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Prob1 APN 18 35653333 missense possibly damaging 0.91
IGL02352:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02359:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02823:Prob1 APN 18 35652747 missense possibly damaging 0.86
IGL03003:Prob1 APN 18 35653375 missense possibly damaging 0.73
IGL03390:Prob1 APN 18 35654139 missense probably benign 0.03
R0257:Prob1 UTSW 18 35653039 missense possibly damaging 0.53
R0421:Prob1 UTSW 18 35653030 missense possibly damaging 0.70
R0457:Prob1 UTSW 18 35652486 missense probably damaging 0.98
R0485:Prob1 UTSW 18 35653825 missense possibly damaging 0.53
R0575:Prob1 UTSW 18 35654721 missense possibly damaging 0.85
R1147:Prob1 UTSW 18 35654806 nonsense probably null
R1334:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1727:Prob1 UTSW 18 35654311 missense possibly damaging 0.73
R1753:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1826:Prob1 UTSW 18 35653575 missense possibly damaging 0.72
R1895:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R1937:Prob1 UTSW 18 35654226 missense possibly damaging 0.53
R2170:Prob1 UTSW 18 35654737 missense probably benign 0.18
R3435:Prob1 UTSW 18 35654241 missense possibly damaging 0.72
R4749:Prob1 UTSW 18 35652816 missense possibly damaging 0.91
R4968:Prob1 UTSW 18 35652552 missense probably damaging 0.98
R5107:Prob1 UTSW 18 35652936 missense possibly damaging 0.53
R5602:Prob1 UTSW 18 35654026 missense possibly damaging 0.96
R5646:Prob1 UTSW 18 35654114 missense probably benign 0.18
R6035:Prob1 UTSW 18 35654782 missense probably benign 0.18
R6747:Prob1 UTSW 18 35655154 missense probably damaging 0.97
R6954:Prob1 UTSW 18 35654268 missense probably benign
R7061:Prob1 UTSW 18 35654500 missense probably benign 0.18
R7292:Prob1 UTSW 18 35654550 missense possibly damaging 0.93
R7296:Prob1 UTSW 18 35653299 missense possibly damaging 0.53
R7566:Prob1 UTSW 18 35654985 missense probably benign 0.33
R7723:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R7787:Prob1 UTSW 18 35652232 missense possibly damaging 0.73
R7798:Prob1 UTSW 18 35653344 missense possibly damaging 0.93
R8048:Prob1 UTSW 18 35653551 missense probably benign 0.00
X0067:Prob1 UTSW 18 35653091 missense possibly damaging 0.70
Z1088:Prob1 UTSW 18 35652769 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACATCGTCGTCCAGAGTGCTTG -3'
(R):5'- TCGCTAGAGTTGGGAACCCATGTC -3'

Sequencing Primer
(F):5'- CAGAGTGCTTGTGAGGTGAC -3'
(R):5'- TTGGGAACCCATGTCCTGAAG -3'
Posted On2014-01-05