Mutagenetix > Incidental Mutations

Incidental Mutation 'R1061:Eif2a'

94443

Institutional Source

Beutler Lab

Gene Symbol

Eif2a

Ensembl Gene

ENSMUSG00000027810

Gene Name

eukaryotic translation initiation factor 2A

Synonyms

D3Ertd194e

MMRRC Submission

039147-MU

Accession Numbers

Genbank: NM_001005509.2; Ensembl: ENSMUST00000029387

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1061 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58525821-58557501 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 58545065 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 165 (Y165*)

Ref Sequence

ENSEMBL: ENSMUSP00000120901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]

Predicted Effect

probably null
Transcript: ENSMUST00000029387
AA Change: Y182*

SMART Domains

Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: Y182*

Domain	Start	End	E-Value	Type
low complexity region	145	159	N/A	INTRINSIC
Pfam:eIF2A	216	411	1e-77	PFAM
low complexity region	488	502	N/A	INTRINSIC
coiled coil region	528	575	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137469

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138827

Predicted Effect

probably null
Transcript: ENSMUST00000138848
AA Change: Y165*

SMART Domains

Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810
AA Change: Y165*

Domain	Start	End	E-Value	Type
SCOP:d1kb0a2	27	160	5e-9	SMART
Pfam:eIF2A	199	251	1.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148251

Predicted Effect

probably benign
Transcript: ENSMUST00000154219

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,277,809	A715T	probably benign	Het
Ampd2	A	G	3: 108,075,689	Y641H	probably damaging	Het
Aqp4	A	T	18: 15,398,191	V171E	probably damaging	Het
Arid4a	T	A	12: 71,074,955	S381R	probably damaging	Het
Armc8	T	G	9: 99,537,731	N51H	probably damaging	Het
Asic5	T	A	3: 82,021,001	Y424N	probably damaging	Het
Bcl11a	A	T	11: 24,164,069	K471*	probably null	Het
Birc6	A	G	17: 74,689,312	T4494A	probably damaging	Het
Btbd9	A	G	17: 30,527,435	I139T	probably benign	Het
Ccdc114	T	C	7: 45,941,755	I218T	probably damaging	Het
Ccdc60	C	A	5: 116,172,468	R178S	possibly damaging	Het
Cd163	C	T	6: 124,309,169	A226V	probably benign	Het
Cog1	T	G	11: 113,652,037	S170A	probably benign	Het
Cwc15	T	C	9: 14,507,915	L169P	probably damaging	Het
Cyp3a25	A	T	5: 145,986,833	D333E	probably benign	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Dlc1	T	A	8: 36,858,051	T367S	probably benign	Het
Dnah17	T	C	11: 118,052,688	D3183G	possibly damaging	Het
Eml6	T	C	11: 29,777,267	D1285G	probably damaging	Het
Fam92b	C	A	8: 120,169,704		probably null	Het
Fasn	T	C	11: 120,822,182		probably null	Het
Fbn1	T	C	2: 125,345,963	T1549A	probably benign	Het
Fezf2	T	C	14: 12,342,713	Y384C	probably damaging	Het
Flvcr1	A	T	1: 191,008,173	V550E	probably benign	Het
Gcm2	A	G	13: 41,105,871	W41R	probably damaging	Het
Gli2	A	T	1: 118,854,517	M160K	possibly damaging	Het
Gpr61	C	T	3: 108,150,307	R346H	probably damaging	Het
Hoxa5	A	T	6: 52,204,155	S66T	probably benign	Het
Hsph1	A	T	5: 149,618,418	V781D	possibly damaging	Het
Kdm3b	G	A	18: 34,796,862	V220M	probably damaging	Het
Klhl25	T	A	7: 75,866,520	Y391*	probably null	Het
Mc2r	A	T	18: 68,407,809	Y138N	probably damaging	Het
Mtap	C	A	4: 89,156,584	D106E	probably benign	Het
Nup43	G	T	10: 7,667,671	W37L	probably damaging	Het
Nxpe2	T	A	9: 48,326,363	E197D	probably damaging	Het
Olfr1098	A	T	2: 86,922,782	V250D	possibly damaging	Het
Olfr484	T	C	7: 108,124,456	Y269C	probably damaging	Het
Olfr544	T	A	7: 102,484,114	*335C	probably null	Het
Olfr934	C	A	9: 38,982,483	C187F	probably damaging	Het
Pitrm1	A	G	13: 6,555,575	H186R	probably damaging	Het
Pklr	C	T	3: 89,144,881	R467C	probably damaging	Het
Plxna2	A	G	1: 194,644,093	N112D	probably damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp3cb	A	C	14: 20,508,614		probably null	Het
R3hcc1l	C	T	19: 42,583,426	R135*	probably null	Het
Ralyl	A	C	3: 14,115,701	D68A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
S100a1	T	C	3: 90,511,312	N65S	probably damaging	Het
Scn11a	A	T	9: 119,795,663	M531K	probably damaging	Het
Slc5a5	T	A	8: 70,890,221	M232L	probably benign	Het
Tet3	A	T	6: 83,373,323	N1054K	probably damaging	Het
Tg	A	G	15: 66,698,559	N1427D	probably benign	Het
Tns1	A	C	1: 73,917,672	V530G	probably damaging	Het
Trcg1	C	A	9: 57,245,873	Q600K	possibly damaging	Het
Tshz3	A	G	7: 36,768,706	E40G	probably damaging	Het
Usp34	T	C	11: 23,384,420	F1138S	possibly damaging	Het
Vmn2r26	C	T	6: 124,061,644	T726I	probably benign	Het
Vmn2r97	A	T	17: 18,928,178	R112*	probably null	Het
Vwa2	G	T	19: 56,908,994	R577L	probably benign	Het
Vwa3b	A	C	1: 37,157,430	Q46P	probably damaging	Het
Wdr25	T	A	12: 108,992,799		probably null	Het
Wrap53	A	G	11: 69,562,400	L405P	probably damaging	Het
Zfp629	C	A	7: 127,611,989	W216L	probably damaging	Het

Other mutations in Eif2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02323:Eif2a	APN	3	58548603	missense	possibly damaging	0.89
IGL02823:Eif2a	APN	3	58548671	missense	probably benign	0.01
IGL03086:Eif2a	APN	3	58541117	missense	probably benign	0.00
IGL03165:Eif2a	APN	3	58548628	nonsense	probably null
1mM(1):Eif2a	UTSW	3	58545303	missense	possibly damaging	0.75
PIT4576001:Eif2a	UTSW	3	58545553	missense	probably damaging	1.00
R0540:Eif2a	UTSW	3	58555652	critical splice donor site	probably null
R0607:Eif2a	UTSW	3	58555652	critical splice donor site	probably null
R1499:Eif2a	UTSW	3	58537584	nonsense	probably null
R1922:Eif2a	UTSW	3	58548530	missense	probably damaging	1.00
R3980:Eif2a	UTSW	3	58539539	missense	probably benign	0.00
R4017:Eif2a	UTSW	3	58545355	missense	probably damaging	1.00
R4080:Eif2a	UTSW	3	58539629	missense	possibly damaging	0.52
R5528:Eif2a	UTSW	3	58548512	missense	probably damaging	1.00
R6320:Eif2a	UTSW	3	58557096	splice site	probably null
R7081:Eif2a	UTSW	3	58541718	critical splice donor site	probably null
R7414:Eif2a	UTSW	3	58526081	nonsense	probably null
R7447:Eif2a	UTSW	3	58545542	missense	probably damaging	0.97
R7497:Eif2a	UTSW	3	58548681	missense	probably damaging	1.00
R7701:Eif2a	UTSW	3	58552570	missense	possibly damaging	0.72
R8205:Eif2a	UTSW	3	58548735	missense	probably damaging	1.00
Z1176:Eif2a	UTSW	3	58548884	missense	probably benign
Z1177:Eif2a	UTSW	3	58531120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCTGAGGCTGATCTTTCCCATC -3'
(R):5'- TGAGGTCCGGCAAAGTTGGGATAC -3'

Sequencing Primer
(F):5'- gctctgcctcattacatgaaac -3'
(R):5'- AAGCACATAAACTGAGATGGATG -3'

Posted On

2014-01-05