Incidental Mutation 'R1061:Eif2a'
ID94443
Institutional Source Beutler Lab
Gene Symbol Eif2a
Ensembl Gene ENSMUSG00000027810
Gene Nameeukaryotic translation initiation factor 2A
SynonymsD3Ertd194e
MMRRC Submission 039147-MU
Accession Numbers

Genbank: NM_001005509.2; Ensembl: ENSMUST00000029387

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1061 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58525821-58557501 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 58545065 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 165 (Y165*)
Ref Sequence ENSEMBL: ENSMUSP00000120901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]
Predicted Effect probably null
Transcript: ENSMUST00000029387
AA Change: Y182*
SMART Domains Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: Y182*

DomainStartEndE-ValueType
low complexity region 145 159 N/A INTRINSIC
Pfam:eIF2A 216 411 1e-77 PFAM
low complexity region 488 502 N/A INTRINSIC
coiled coil region 528 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138827
Predicted Effect probably null
Transcript: ENSMUST00000138848
AA Change: Y165*
SMART Domains Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810
AA Change: Y165*

DomainStartEndE-ValueType
SCOP:d1kb0a2 27 160 5e-9 SMART
Pfam:eIF2A 199 251 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148251
Predicted Effect probably benign
Transcript: ENSMUST00000154219
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Eif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Eif2a APN 3 58548603 missense possibly damaging 0.89
IGL02823:Eif2a APN 3 58548671 missense probably benign 0.01
IGL03086:Eif2a APN 3 58541117 missense probably benign 0.00
IGL03165:Eif2a APN 3 58548628 nonsense probably null
1mM(1):Eif2a UTSW 3 58545303 missense possibly damaging 0.75
PIT4576001:Eif2a UTSW 3 58545553 missense probably damaging 1.00
R0540:Eif2a UTSW 3 58555652 critical splice donor site probably null
R0607:Eif2a UTSW 3 58555652 critical splice donor site probably null
R1499:Eif2a UTSW 3 58537584 nonsense probably null
R1922:Eif2a UTSW 3 58548530 missense probably damaging 1.00
R3980:Eif2a UTSW 3 58539539 missense probably benign 0.00
R4017:Eif2a UTSW 3 58545355 missense probably damaging 1.00
R4080:Eif2a UTSW 3 58539629 missense possibly damaging 0.52
R5528:Eif2a UTSW 3 58548512 missense probably damaging 1.00
R6320:Eif2a UTSW 3 58557096 intron probably null
R7081:Eif2a UTSW 3 58541718 critical splice donor site probably null
R7414:Eif2a UTSW 3 58526081 nonsense probably null
R7447:Eif2a UTSW 3 58545542 missense probably damaging 0.97
R7497:Eif2a UTSW 3 58548681 missense probably damaging 1.00
R7701:Eif2a UTSW 3 58552570 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGGCTGAGGCTGATCTTTCCCATC -3'
(R):5'- TGAGGTCCGGCAAAGTTGGGATAC -3'

Sequencing Primer
(F):5'- gctctgcctcattacatgaaac -3'
(R):5'- AAGCACATAAACTGAGATGGATG -3'
Posted On2014-01-05