Incidental Mutation 'R1061:Pklr'
ID 94447
Institutional Source Beutler Lab
Gene Symbol Pklr
Ensembl Gene ENSMUSG00000041237
Gene Name pyruvate kinase liver and red blood cell
Synonyms Pk1, R-PK, Pk-1
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R1061 (G1)
Quality Score 139
Status Not validated
Chromosome 3
Chromosomal Location 89136142-89146784 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89144881 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 467 (R467C)
Ref Sequence ENSEMBL: ENSMUSP00000103106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029686] [ENSMUST00000047111] [ENSMUST00000107482] [ENSMUST00000127058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029686
SMART Domains Protein: ENSMUSP00000029686
Gene: ENSMUSG00000028051

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
Pfam:Ion_trans_N 48 91 1.3e-22 PFAM
Pfam:Ion_trans 92 357 3.7e-25 PFAM
low complexity region 358 369 N/A INTRINSIC
Blast:cNMP 370 402 7e-14 BLAST
cNMP 427 540 2.32e-20 SMART
Blast:cNMP 548 588 2e-17 BLAST
low complexity region 636 656 N/A INTRINSIC
low complexity region 698 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047111
AA Change: R498C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035417
Gene: ENSMUSG00000041237
AA Change: R498C

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PK 85 438 6.9e-165 PFAM
Pfam:PK_C 453 571 3.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107482
AA Change: R467C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103106
Gene: ENSMUSG00000041237
AA Change: R467C

DomainStartEndE-ValueType
Pfam:PK 54 407 3.1e-163 PFAM
Pfam:PK_C 421 541 4.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127058
SMART Domains Protein: ENSMUSP00000119392
Gene: ENSMUSG00000041237

DomainStartEndE-ValueType
Pfam:PK 21 72 7.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148097
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyruvate kinase that catalyzes the transphosphorylation of phohsphoenolpyruvate into pyruvate and ATP, which is the rate-limiting step of glycolysis. Defects in this enzyme, due to gene mutations or genetic variations, are the common cause of chronic hereditary nonspherocytic hemolytic anemia (CNSHA or HNSHA). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for loss of function mutations in this gene suffer from hemolytic anemia. This is also a candidate gene for malaria resistance QTL Char4 and immunity to Salmonella typhimurium QTL Ity4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Pklr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Pklr APN 3 89144995 missense probably damaging 1.00
IGL02108:Pklr APN 3 89137403 missense probably damaging 1.00
IGL03030:Pklr APN 3 89142656 missense probably damaging 1.00
IGL03401:Pklr APN 3 89142729 missense probably benign 0.41
R0088:Pklr UTSW 3 89141908 missense probably damaging 1.00
R0801:Pklr UTSW 3 89145522 nonsense probably null
R1434:Pklr UTSW 3 89143035 missense probably damaging 1.00
R2030:Pklr UTSW 3 89143238 missense probably damaging 1.00
R2131:Pklr UTSW 3 89142660 missense probably damaging 1.00
R3703:Pklr UTSW 3 89142701 missense probably damaging 1.00
R4372:Pklr UTSW 3 89145523 nonsense probably null
R5279:Pklr UTSW 3 89143259 missense probably damaging 1.00
R5401:Pklr UTSW 3 89141866 missense probably damaging 1.00
R5809:Pklr UTSW 3 89141784 missense probably benign
R5946:Pklr UTSW 3 89136196 missense probably benign 0.43
R6331:Pklr UTSW 3 89137355 missense probably damaging 0.99
R7559:Pklr UTSW 3 89143058 missense probably damaging 1.00
R7711:Pklr UTSW 3 89141342 missense probably damaging 1.00
R7848:Pklr UTSW 3 89142978 missense possibly damaging 0.81
R7943:Pklr UTSW 3 89141507 missense probably damaging 0.99
R8145:Pklr UTSW 3 89145488 missense probably benign
R8953:Pklr UTSW 3 89142305 missense probably damaging 1.00
R8964:Pklr UTSW 3 89142729 missense probably benign 0.41
R9195:Pklr UTSW 3 89141329 missense probably damaging 1.00
Z1176:Pklr UTSW 3 89144855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGACTGAGCCATCTCTCTAGCC -3'
(R):5'- AGAGTCCAAGACACACCCATCTTAGTG -3'

Sequencing Primer
(F):5'- tgccagtgaagaccagaag -3'
(R):5'- TGACTCCTAGAAAACTCTTGGGC -3'
Posted On 2014-01-05