Incidental Mutation 'R1061:S100a1'
ID 94448
Institutional Source Beutler Lab
Gene Symbol S100a1
Ensembl Gene ENSMUSG00000044080
Gene Name S100 calcium binding protein A1
Synonyms S100a, S100
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 90511034-90514392 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90511312 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 65 (N65S)
Ref Sequence ENSEMBL: ENSMUSP00000058237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001043] [ENSMUST00000048138] [ENSMUST00000049937] [ENSMUST00000060738] [ENSMUST00000076639] [ENSMUST00000107340] [ENSMUST00000107342] [ENSMUST00000107343] [ENSMUST00000107344] [ENSMUST00000107346] [ENSMUST00000131868] [ENSMUST00000146740]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000001043
SMART Domains Protein: ENSMUSP00000001043
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048138
SMART Domains Protein: ENSMUSP00000047737
Gene: ENSMUSG00000042312

DomainStartEndE-ValueType
Pfam:S_100 71 113 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049937
SMART Domains Protein: ENSMUSP00000061800
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
FoP_duplication 158 246 3.35e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060738
AA Change: N65S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058237
Gene: ENSMUSG00000044080
AA Change: N65S

DomainStartEndE-ValueType
Pfam:S_100 5 47 5.8e-23 PFAM
Pfam:EF-hand_1 54 82 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076639
SMART Domains Protein: ENSMUSP00000075936
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
Blast:FoP_duplication 59 84 3e-6 BLAST
low complexity region 86 108 N/A INTRINSIC
FoP_duplication 114 199 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107340
SMART Domains Protein: ENSMUSP00000102963
Gene: ENSMUSG00000044080

DomainStartEndE-ValueType
Pfam:S_100 5 48 1.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107342
SMART Domains Protein: ENSMUSP00000102965
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Blast:FoP_duplication 34 59 3e-6 BLAST
low complexity region 61 83 N/A INTRINSIC
FoP_duplication 89 174 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107343
SMART Domains Protein: ENSMUSP00000102966
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
FoP_duplication 90 175 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107344
SMART Domains Protein: ENSMUSP00000102967
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 62 84 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
FoP_duplication 133 221 3.35e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107346
SMART Domains Protein: ENSMUSP00000102969
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
FoP_duplication 115 200 1.21e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131868
SMART Domains Protein: ENSMUSP00000123448
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 69 83 N/A INTRINSIC
low complexity region 87 109 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146740
SMART Domains Protein: ENSMUSP00000116945
Gene: ENSMUSG00000001017

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 139 159 N/A INTRINSIC
low complexity region 177 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of protein kinase C-mediated phosphorylation. Reduced expression of this protein has been implicated in cardiomyopathies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous and heterozygous mice exhibit a reduced cardiac contractility in response to chronic hemodynamic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in S100a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1183:S100a1 UTSW 3 90511334 missense probably benign
R1766:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R2282:S100a1 UTSW 3 90511292 missense probably damaging 1.00
R4615:S100a1 UTSW 3 90511255 missense possibly damaging 0.63
R5397:S100a1 UTSW 3 90512135 start codon destroyed probably null 1.00
R7852:S100a1 UTSW 3 90512085 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATCTGGACTGCCACTCTTGTGC -3'
(R):5'- GTCTGTAAGGTTCCCAGCTTGTCAC -3'

Sequencing Primer
(F):5'- TGCACGTCGAGACTGGG -3'
(R):5'- agccatctcaccagtccc -3'
Posted On 2014-01-05