Incidental Mutation 'R1061:Ampd2'
ID 94449
Institutional Source Beutler Lab
Gene Symbol Ampd2
Ensembl Gene ENSMUSG00000027889
Gene Name adenosine monophosphate deaminase 2
Synonyms 1200014F01Rik, Ampd-2
MMRRC Submission 039147-MU
Accession Numbers

Genbank: NM_028779; MGI: 88016

Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R1061 (G1)
Quality Score 179
Status Not validated
Chromosome 3
Chromosomal Location 108074062-108086651 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108075689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 641 (Y641H)
Ref Sequence ENSEMBL: ENSMUSP00000099698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078912] [ENSMUST00000102637] [ENSMUST00000102638]
AlphaFold Q9DBT5
Predicted Effect probably damaging
Transcript: ENSMUST00000078912
AA Change: Y667H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077946
Gene: ENSMUSG00000027889
AA Change: Y667H

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 357 764 3.3e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102637
AA Change: Y641H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099697
Gene: ENSMUSG00000027889
AA Change: Y641H

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102638
AA Change: Y641H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099698
Gene: ENSMUSG00000027889
AA Change: Y641H

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106667
SMART Domains Protein: ENSMUSP00000102278
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
Pfam:A_deaminase 1 42 5.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136712
SMART Domains Protein: ENSMUSP00000122431
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
Pfam:A_deaminase 97 165 4.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153626
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit proteinuria, tubules filled with protein casts and podocyte process effacement. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Ampd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ampd2 APN 3 108077396 missense probably damaging 1.00
IGL02142:Ampd2 APN 3 108080344 splice site probably benign
IGL02174:Ampd2 APN 3 108080285 missense probably damaging 0.96
IGL02686:Ampd2 APN 3 108076495 missense possibly damaging 0.62
IGL03326:Ampd2 APN 3 108079287 missense probably benign 0.02
IGL03493:Ampd2 APN 3 108075358 missense probably damaging 1.00
D4186:Ampd2 UTSW 3 108081111 missense probably benign 0.00
H8562:Ampd2 UTSW 3 108081111 missense probably benign 0.00
PIT4445001:Ampd2 UTSW 3 108075012 missense probably damaging 1.00
R0271:Ampd2 UTSW 3 108086716 unclassified probably benign
R0835:Ampd2 UTSW 3 108076502 missense possibly damaging 0.48
R0975:Ampd2 UTSW 3 108077121 missense probably damaging 1.00
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1584:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R2034:Ampd2 UTSW 3 108077363 missense possibly damaging 0.91
R2164:Ampd2 UTSW 3 108085369 intron probably benign
R3040:Ampd2 UTSW 3 108076416 missense probably damaging 1.00
R3052:Ampd2 UTSW 3 108086487 utr 5 prime probably benign
R4329:Ampd2 UTSW 3 108077787 intron probably benign
R4425:Ampd2 UTSW 3 108086736 unclassified probably benign
R5073:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5074:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5180:Ampd2 UTSW 3 108079042 missense probably benign 0.00
R5256:Ampd2 UTSW 3 108079549 intron probably benign
R5507:Ampd2 UTSW 3 108077613 missense probably damaging 1.00
R5513:Ampd2 UTSW 3 108075667 missense possibly damaging 0.85
R5955:Ampd2 UTSW 3 108079772 missense probably damaging 1.00
R6941:Ampd2 UTSW 3 108079293 missense probably damaging 0.99
R7744:Ampd2 UTSW 3 108080116 missense probably benign
R7745:Ampd2 UTSW 3 108080116 missense probably benign
R7815:Ampd2 UTSW 3 108074931 missense probably benign 0.06
R7938:Ampd2 UTSW 3 108080116 missense probably benign
R7939:Ampd2 UTSW 3 108080116 missense probably benign
R7941:Ampd2 UTSW 3 108080116 missense probably benign
R7942:Ampd2 UTSW 3 108080116 missense probably benign
R8309:Ampd2 UTSW 3 108080116 missense probably benign
R8312:Ampd2 UTSW 3 108080116 missense probably benign
R8503:Ampd2 UTSW 3 108080116 missense probably benign
R8518:Ampd2 UTSW 3 108080116 missense probably benign
R8724:Ampd2 UTSW 3 108080116 missense probably benign
R8743:Ampd2 UTSW 3 108080116 missense probably benign
R8745:Ampd2 UTSW 3 108080116 missense probably benign
R8753:Ampd2 UTSW 3 108080116 missense probably benign
R8769:Ampd2 UTSW 3 108075297 missense probably damaging 0.98
R9339:Ampd2 UTSW 3 108080300 missense probably damaging 0.96
R9410:Ampd2 UTSW 3 108075274 missense probably damaging 1.00
Z1176:Ampd2 UTSW 3 108080064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCTAAGCTCCAGCAGCAAG -3'
(R):5'- AGCCCAGCCCAGGATTCATCATTC -3'

Sequencing Primer
(F):5'- TAGAGGCACCCAGTATCCC -3'
(R):5'- AGCCCAGGATTCATCATTCTTATG -3'
Posted On 2014-01-05