Mutagenetix > Incidental Mutations

Incidental Mutation 'R1061:Gpr61'

94450

Institutional Source

Beutler Lab

Gene Symbol

Gpr61

Ensembl Gene

ENSMUSG00000046793

Gene Name

G protein-coupled receptor 61

Synonyms

MMRRC Submission

039147-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1061 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108148321-108154882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108150307 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 346 (R346H)

Ref Sequence

ENSEMBL: ENSMUSP00000111988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000001] [ENSMUST00000062028] [ENSMUST00000116284]

Predicted Effect

probably benign
Transcript: ENSMUST00000000001

SMART Domains

Protein: ENSMUSP00000000001
Gene: ENSMUSG00000000001

Domain	Start	End	E-Value	Type
G_alpha	13	353	4.43e-218	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000062028
AA Change: R346H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055557
Gene: ENSMUSG00000046793
AA Change: R346H

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:7tm_1	59	341	1.7e-36	PFAM
low complexity region	394	406	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000116284
AA Change: R346H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111988
Gene: ENSMUSG00000046793
AA Change: R346H

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:7tm_1	59	341	4.2e-41	PFAM
low complexity region	394	406	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family. G protein-coupled receptors contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. The protein encoded by this gene is most closely related to biogenic amine receptors. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,277,809	A715T	probably benign	Het
Ampd2	A	G	3: 108,075,689	Y641H	probably damaging	Het
Aqp4	A	T	18: 15,398,191	V171E	probably damaging	Het
Arid4a	T	A	12: 71,074,955	S381R	probably damaging	Het
Armc8	T	G	9: 99,537,731	N51H	probably damaging	Het
Asic5	T	A	3: 82,021,001	Y424N	probably damaging	Het
Bcl11a	A	T	11: 24,164,069	K471*	probably null	Het
Birc6	A	G	17: 74,689,312	T4494A	probably damaging	Het
Btbd9	A	G	17: 30,527,435	I139T	probably benign	Het
Ccdc114	T	C	7: 45,941,755	I218T	probably damaging	Het
Ccdc60	C	A	5: 116,172,468	R178S	possibly damaging	Het
Cd163	C	T	6: 124,309,169	A226V	probably benign	Het
Cog1	T	G	11: 113,652,037	S170A	probably benign	Het
Cwc15	T	C	9: 14,507,915	L169P	probably damaging	Het
Cyp3a25	A	T	5: 145,986,833	D333E	probably benign	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Dlc1	T	A	8: 36,858,051	T367S	probably benign	Het
Dnah17	T	C	11: 118,052,688	D3183G	possibly damaging	Het
Eif2a	T	A	3: 58,545,065	Y165*	probably null	Het
Eml6	T	C	11: 29,777,267	D1285G	probably damaging	Het
Fam92b	C	A	8: 120,169,704		probably null	Het
Fasn	T	C	11: 120,822,182		probably null	Het
Fbn1	T	C	2: 125,345,963	T1549A	probably benign	Het
Fezf2	T	C	14: 12,342,713	Y384C	probably damaging	Het
Flvcr1	A	T	1: 191,008,173	V550E	probably benign	Het
Gcm2	A	G	13: 41,105,871	W41R	probably damaging	Het
Gli2	A	T	1: 118,854,517	M160K	possibly damaging	Het
Hoxa5	A	T	6: 52,204,155	S66T	probably benign	Het
Hsph1	A	T	5: 149,618,418	V781D	possibly damaging	Het
Kdm3b	G	A	18: 34,796,862	V220M	probably damaging	Het
Klhl25	T	A	7: 75,866,520	Y391*	probably null	Het
Mc2r	A	T	18: 68,407,809	Y138N	probably damaging	Het
Mtap	C	A	4: 89,156,584	D106E	probably benign	Het
Nup43	G	T	10: 7,667,671	W37L	probably damaging	Het
Nxpe2	T	A	9: 48,326,363	E197D	probably damaging	Het
Olfr1098	A	T	2: 86,922,782	V250D	possibly damaging	Het
Olfr484	T	C	7: 108,124,456	Y269C	probably damaging	Het
Olfr544	T	A	7: 102,484,114	*335C	probably null	Het
Olfr934	C	A	9: 38,982,483	C187F	probably damaging	Het
Pitrm1	A	G	13: 6,555,575	H186R	probably damaging	Het
Pklr	C	T	3: 89,144,881	R467C	probably damaging	Het
Plxna2	A	G	1: 194,644,093	N112D	probably damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp3cb	A	C	14: 20,508,614		probably null	Het
R3hcc1l	C	T	19: 42,583,426	R135*	probably null	Het
Ralyl	A	C	3: 14,115,701	D68A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
S100a1	T	C	3: 90,511,312	N65S	probably damaging	Het
Scn11a	A	T	9: 119,795,663	M531K	probably damaging	Het
Slc5a5	T	A	8: 70,890,221	M232L	probably benign	Het
Tet3	A	T	6: 83,373,323	N1054K	probably damaging	Het
Tg	A	G	15: 66,698,559	N1427D	probably benign	Het
Tns1	A	C	1: 73,917,672	V530G	probably damaging	Het
Trcg1	C	A	9: 57,245,873	Q600K	possibly damaging	Het
Tshz3	A	G	7: 36,768,706	E40G	probably damaging	Het
Usp34	T	C	11: 23,384,420	F1138S	possibly damaging	Het
Vmn2r26	C	T	6: 124,061,644	T726I	probably benign	Het
Vmn2r97	A	T	17: 18,928,178	R112*	probably null	Het
Vwa2	G	T	19: 56,908,994	R577L	probably benign	Het
Vwa3b	A	C	1: 37,157,430	Q46P	probably damaging	Het
Wdr25	T	A	12: 108,992,799		probably null	Het
Wrap53	A	G	11: 69,562,400	L405P	probably damaging	Het
Zfp629	C	A	7: 127,611,989	W216L	probably damaging	Het

Other mutations in Gpr61

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Gpr61	APN	3	108151198	missense	probably damaging	1.00
IGL02354:Gpr61	APN	3	108150218	missense	probably damaging	1.00
IGL02878:Gpr61	APN	3	108150028	missense	probably damaging	0.97
R1295:Gpr61	UTSW	3	108150481	missense	possibly damaging	0.78
R1296:Gpr61	UTSW	3	108150481	missense	possibly damaging	0.78
R1329:Gpr61	UTSW	3	108150514	missense	probably benign	0.16
R1718:Gpr61	UTSW	3	108150380	missense	possibly damaging	0.81
R1840:Gpr61	UTSW	3	108150481	missense	possibly damaging	0.78
R2139:Gpr61	UTSW	3	108150761	missense	probably damaging	1.00
R5016:Gpr61	UTSW	3	108150667	missense	possibly damaging	0.63
R7042:Gpr61	UTSW	3	108151331	missense	possibly damaging	0.93
R7689:Gpr61	UTSW	3	108150650	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCGCAAAAGCAGTCCTTGAAATC -3'
(R):5'- AACGCTCTGAGTCTCTCAGTAGCC -3'

Sequencing Primer
(F):5'- AGTTGCTGCTCCAGGAACTC -3'
(R):5'- AAGGCAGCAGTGGTCCTC -3'

Posted On

2014-01-05