Incidental Mutation 'R1061:Mtap'
ID 94452
Institutional Source Beutler Lab
Gene Symbol Mtap
Ensembl Gene ENSMUSG00000062937
Gene Name methylthioadenosine phosphorylase
Synonyms
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 89137122-89181081 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 89156584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 106 (D106E)
Ref Sequence ENSEMBL: ENSMUSP00000061092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058030]
AlphaFold Q9CQ65
Predicted Effect probably benign
Transcript: ENSMUST00000058030
AA Change: D106E

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061092
Gene: ENSMUSG00000062937
AA Change: D106E

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 11 256 3.6e-50 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that plays a major role in polyamine metabolism and is important for the salvage of both adenine and methionine. The encoded enzyme is deficient in many cancers because this gene and the tumor suppressor p16 gene are co-deleted. Multiple alternatively spliced transcript variants have been described for this gene, but their full-length natures remain unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele die by E8.5. Heterozygotes display no significant hearing loss up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Mtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Mtap APN 4 89172357 nonsense probably null
IGL01330:Mtap APN 4 89171223 missense probably damaging 1.00
R0003:Mtap UTSW 4 89151998 splice site probably benign
R1156:Mtap UTSW 4 89171222 missense probably benign 0.41
R1692:Mtap UTSW 4 89176914 missense probably benign 0.00
R4585:Mtap UTSW 4 89172274 missense probably benign
R6513:Mtap UTSW 4 89148261 missense possibly damaging 0.68
R7424:Mtap UTSW 4 89179462 splice site probably null
R9032:Mtap UTSW 4 89172278 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTACAGTTCCCTGCTCTGACGG -3'
(R):5'- CATCCAAGCTAATTTGCGAGGTGTG -3'

Sequencing Primer
(F):5'- ACGGCGGATGTCATACTTC -3'
(R):5'- TCACCATGTAATGTCCACATATAGC -3'
Posted On 2014-01-05