Incidental Mutation 'R1061:Hsph1'
ID 94463
Institutional Source Beutler Lab
Gene Symbol Hsph1
Ensembl Gene ENSMUSG00000029657
Gene Name heat shock 105kDa/110kDa protein 1
Synonyms Hsp105, hsp-E7I, HSP110
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 149614287-149636376 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 149618418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 781 (V781D)
Ref Sequence ENSEMBL: ENSMUSP00000144413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074846] [ENSMUST00000201452] [ENSMUST00000202089] [ENSMUST00000202361]
AlphaFold Q61699
Predicted Effect possibly damaging
Transcript: ENSMUST00000074846
AA Change: V737D

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074392
Gene: ENSMUSG00000029657
AA Change: V737D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201431
Predicted Effect possibly damaging
Transcript: ENSMUST00000201452
AA Change: V781D

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144654
Gene: ENSMUSG00000029657
AA Change: V781D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201877
Predicted Effect possibly damaging
Transcript: ENSMUST00000202089
AA Change: V740D

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144297
Gene: ENSMUSG00000029657
AA Change: V740D

DomainStartEndE-ValueType
Pfam:HSP70 3 103 1.3e-33 PFAM
Pfam:HSP70 98 668 8.5e-135 PFAM
low complexity region 715 727 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202137
Predicted Effect possibly damaging
Transcript: ENSMUST00000202361
AA Change: V781D

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144413
Gene: ENSMUSG00000029657
AA Change: V781D

DomainStartEndE-ValueType
Pfam:HSP70 3 709 7.3e-190 PFAM
low complexity region 756 768 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene leads to decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Hsph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Hsph1 APN 5 149618789 missense possibly damaging 0.95
IGL00839:Hsph1 APN 5 149618454 missense possibly damaging 0.47
IGL00965:Hsph1 APN 5 149630804 missense probably damaging 1.00
IGL01529:Hsph1 APN 5 149636034 missense probably benign 0.01
IGL01613:Hsph1 APN 5 149627278 missense probably benign 0.34
IGL02023:Hsph1 APN 5 149633859 missense probably damaging 1.00
IGL02272:Hsph1 APN 5 149617530 missense probably benign 0.00
IGL02754:Hsph1 APN 5 149623592 missense possibly damaging 0.95
R0666:Hsph1 UTSW 5 149631502 missense probably damaging 1.00
R1163:Hsph1 UTSW 5 149630801 missense probably damaging 1.00
R1511:Hsph1 UTSW 5 149630383 missense probably benign 0.03
R1794:Hsph1 UTSW 5 149630773 missense probably damaging 1.00
R1806:Hsph1 UTSW 5 149629989 missense probably damaging 0.99
R1847:Hsph1 UTSW 5 149623485 nonsense probably null
R2143:Hsph1 UTSW 5 149631486 missense probably damaging 0.99
R2144:Hsph1 UTSW 5 149630337 critical splice donor site probably null
R2917:Hsph1 UTSW 5 149630786 nonsense probably null
R3840:Hsph1 UTSW 5 149620715 splice site probably null
R3841:Hsph1 UTSW 5 149620715 splice site probably null
R4378:Hsph1 UTSW 5 149636007 nonsense probably null
R4577:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4618:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R4621:Hsph1 UTSW 5 149618843 missense probably benign 0.03
R5898:Hsph1 UTSW 5 149625158 missense probably damaging 1.00
R6114:Hsph1 UTSW 5 149627387 missense possibly damaging 0.53
R6185:Hsph1 UTSW 5 149617695 missense probably damaging 1.00
R6432:Hsph1 UTSW 5 149618976 missense probably damaging 0.99
R6678:Hsph1 UTSW 5 149618497 missense probably benign 0.00
R7014:Hsph1 UTSW 5 149630400 missense probably damaging 1.00
R7189:Hsph1 UTSW 5 149630460 missense probably damaging 1.00
R7438:Hsph1 UTSW 5 149619020 missense probably damaging 1.00
R7502:Hsph1 UTSW 5 149630373 missense probably damaging 1.00
R7621:Hsph1 UTSW 5 149632075 missense probably damaging 0.99
R7625:Hsph1 UTSW 5 149618436 missense probably benign 0.00
R8480:Hsph1 UTSW 5 149627564 missense probably null 1.00
R8841:Hsph1 UTSW 5 149627324 missense probably damaging 0.97
R8858:Hsph1 UTSW 5 149625111 missense probably damaging 1.00
R9031:Hsph1 UTSW 5 149629805 missense probably damaging 0.99
R9371:Hsph1 UTSW 5 149619930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTCAAGGACACACTGCCAAC -3'
(R):5'- AGGGAGTGACCTGACTTAGCCAAC -3'

Sequencing Primer
(F):5'- CCAGGACAGACGTAGCTAGAAC -3'
(R):5'- CCTGACTTAGCCAACATGTGG -3'
Posted On 2014-01-05