Incidental Mutation 'R1061:Hoxa5'
ID 94465
Institutional Source Beutler Lab
Gene Symbol Hoxa5
Ensembl Gene ENSMUSG00000038253
Gene Name homeobox A5
Synonyms Hox-1.3
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock # R1061 (G1)
Quality Score 129
Status Not validated
Chromosome 6
Chromosomal Location 52201754-52204587 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52204155 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 66 (S66T)
Ref Sequence ENSEMBL: ENSMUSP00000039012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048794] [ENSMUST00000062829] [ENSMUST00000114434] [ENSMUST00000128102]
AlphaFold P09021
Predicted Effect probably benign
Transcript: ENSMUST00000048794
AA Change: S66T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039012
Gene: ENSMUSG00000038253
AA Change: S66T

DomainStartEndE-ValueType
low complexity region 65 86 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 146 175 N/A INTRINSIC
HOX 195 257 1.63e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062829
SMART Domains Protein: ENSMUSP00000058755
Gene: ENSMUSG00000043219

DomainStartEndE-ValueType
HOX 154 216 2.43e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142764
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Methylation of this gene may result in the loss of its expression and, since the encoded protein upregulates the tumor suppressor p53, this protein may play an important role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show skeletal defects, tracheal and lung dysmorphology, reduced surfactant production, emphysema, and partial neonatal lethality. Survivors show stunted growth, delayed ear elevation and eyelid opening, and altered thyroid development, digestive secretion, and ovarian biology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Hoxa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Hoxa5 APN 6 52204331 missense probably damaging 1.00
IGL01885:Hoxa5 APN 6 52202667 missense probably damaging 1.00
IGL02021:Hoxa5 APN 6 52202657 missense probably damaging 1.00
IGL02631:Hoxa5 APN 6 52203810 missense probably damaging 1.00
IGL02885:Hoxa5 APN 6 52202708 missense probably damaging 1.00
R0377:Hoxa5 UTSW 6 52202646 missense probably damaging 1.00
R0543:Hoxa5 UTSW 6 52204340 missense probably damaging 1.00
R1460:Hoxa5 UTSW 6 52203948 missense probably benign 0.00
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1465:Hoxa5 UTSW 6 52203791 missense probably benign 0.37
R1804:Hoxa5 UTSW 6 52202648 missense probably damaging 1.00
R1822:Hoxa5 UTSW 6 52202732 missense probably damaging 1.00
R2332:Hoxa5 UTSW 6 52202679 missense probably damaging 1.00
R4303:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
R4796:Hoxa5 UTSW 6 52203963 missense probably benign 0.01
R5642:Hoxa5 UTSW 6 52204217 missense probably damaging 1.00
R6212:Hoxa5 UTSW 6 52202714 missense probably damaging 1.00
R7134:Hoxa5 UTSW 6 52204043 missense probably damaging 1.00
R7172:Hoxa5 UTSW 6 52204296 missense probably damaging 1.00
R8037:Hoxa5 UTSW 6 52204329 missense probably damaging 1.00
R8038:Hoxa5 UTSW 6 52204329 missense probably damaging 1.00
R8199:Hoxa5 UTSW 6 52204260 missense probably benign 0.01
R8947:Hoxa5 UTSW 6 52202796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTTACCGTGACTAATGTGCAG -3'
(R):5'- TATCCAAATGGCCCGGACTACCAG -3'

Sequencing Primer
(F):5'- AGATCTGGGGCTGAGCG -3'
(R):5'- AGTTCCGTGAGCGAACAA -3'
Posted On 2014-01-05