Mutagenetix > Incidental Mutations

Incidental Mutation 'R1061:Tshz3'

94472

Institutional Source

Beutler Lab

Gene Symbol

Tshz3

Ensembl Gene

ENSMUSG00000021217

Gene Name

teashirt zinc finger family member 3

Synonyms

Tsh3, teashirt3, A630038G13Rik, Zfp537

MMRRC Submission

039147-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1061 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36698118-36773553 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36768706 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 40 (E40G)

Ref Sequence

ENSEMBL: ENSMUSP00000021641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021641]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021641
AA Change: E40G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217
AA Change: E40G

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
low complexity region	123	138	N/A	INTRINSIC
low complexity region	142	164	N/A	INTRINSIC
ZnF_C2H2	214	238	1.86e0	SMART
ZnF_C2H2	275	299	3.83e-2	SMART
low complexity region	313	334	N/A	INTRINSIC
ZnF_C2H2	386	410	5.62e0	SMART
low complexity region	483	497	N/A	INTRINSIC
coiled coil region	609	630	N/A	INTRINSIC
low complexity region	796	832	N/A	INTRINSIC
low complexity region	855	872	N/A	INTRINSIC
HOX	890	964	2.55e-4	SMART
ZnF_C2H2	976	998	8.09e0	SMART
ZnF_C2H2	1041	1064	2.4e-3	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,277,809	A715T	probably benign	Het
Ampd2	A	G	3: 108,075,689	Y641H	probably damaging	Het
Aqp4	A	T	18: 15,398,191	V171E	probably damaging	Het
Arid4a	T	A	12: 71,074,955	S381R	probably damaging	Het
Armc8	T	G	9: 99,537,731	N51H	probably damaging	Het
Asic5	T	A	3: 82,021,001	Y424N	probably damaging	Het
Bcl11a	A	T	11: 24,164,069	K471*	probably null	Het
Birc6	A	G	17: 74,689,312	T4494A	probably damaging	Het
Btbd9	A	G	17: 30,527,435	I139T	probably benign	Het
Ccdc114	T	C	7: 45,941,755	I218T	probably damaging	Het
Ccdc60	C	A	5: 116,172,468	R178S	possibly damaging	Het
Cd163	C	T	6: 124,309,169	A226V	probably benign	Het
Cog1	T	G	11: 113,652,037	S170A	probably benign	Het
Cwc15	T	C	9: 14,507,915	L169P	probably damaging	Het
Cyp3a25	A	T	5: 145,986,833	D333E	probably benign	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Dlc1	T	A	8: 36,858,051	T367S	probably benign	Het
Dnah17	T	C	11: 118,052,688	D3183G	possibly damaging	Het
Eif2a	T	A	3: 58,545,065	Y165*	probably null	Het
Eml6	T	C	11: 29,777,267	D1285G	probably damaging	Het
Fam92b	C	A	8: 120,169,704		probably null	Het
Fasn	T	C	11: 120,822,182		probably null	Het
Fbn1	T	C	2: 125,345,963	T1549A	probably benign	Het
Fezf2	T	C	14: 12,342,713	Y384C	probably damaging	Het
Flvcr1	A	T	1: 191,008,173	V550E	probably benign	Het
Gcm2	A	G	13: 41,105,871	W41R	probably damaging	Het
Gli2	A	T	1: 118,854,517	M160K	possibly damaging	Het
Gpr61	C	T	3: 108,150,307	R346H	probably damaging	Het
Hoxa5	A	T	6: 52,204,155	S66T	probably benign	Het
Hsph1	A	T	5: 149,618,418	V781D	possibly damaging	Het
Kdm3b	G	A	18: 34,796,862	V220M	probably damaging	Het
Klhl25	T	A	7: 75,866,520	Y391*	probably null	Het
Mc2r	A	T	18: 68,407,809	Y138N	probably damaging	Het
Mtap	C	A	4: 89,156,584	D106E	probably benign	Het
Nup43	G	T	10: 7,667,671	W37L	probably damaging	Het
Nxpe2	T	A	9: 48,326,363	E197D	probably damaging	Het
Olfr1098	A	T	2: 86,922,782	V250D	possibly damaging	Het
Olfr484	T	C	7: 108,124,456	Y269C	probably damaging	Het
Olfr544	T	A	7: 102,484,114	*335C	probably null	Het
Olfr934	C	A	9: 38,982,483	C187F	probably damaging	Het
Pitrm1	A	G	13: 6,555,575	H186R	probably damaging	Het
Pklr	C	T	3: 89,144,881	R467C	probably damaging	Het
Plxna2	A	G	1: 194,644,093	N112D	probably damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp3cb	A	C	14: 20,508,614		probably null	Het
R3hcc1l	C	T	19: 42,583,426	R135*	probably null	Het
Ralyl	A	C	3: 14,115,701	D68A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
S100a1	T	C	3: 90,511,312	N65S	probably damaging	Het
Scn11a	A	T	9: 119,795,663	M531K	probably damaging	Het
Slc5a5	T	A	8: 70,890,221	M232L	probably benign	Het
Tet3	A	T	6: 83,373,323	N1054K	probably damaging	Het
Tg	A	G	15: 66,698,559	N1427D	probably benign	Het
Tns1	A	C	1: 73,917,672	V530G	probably damaging	Het
Trcg1	C	A	9: 57,245,873	Q600K	possibly damaging	Het
Usp34	T	C	11: 23,384,420	F1138S	possibly damaging	Het
Vmn2r26	C	T	6: 124,061,644	T726I	probably benign	Het
Vmn2r97	A	T	17: 18,928,178	R112*	probably null	Het
Vwa2	G	T	19: 56,908,994	R577L	probably benign	Het
Vwa3b	A	C	1: 37,157,430	Q46P	probably damaging	Het
Wdr25	T	A	12: 108,992,799		probably null	Het
Wrap53	A	G	11: 69,562,400	L405P	probably damaging	Het
Zfp629	C	A	7: 127,611,989	W216L	probably damaging	Het

Other mutations in Tshz3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01875:Tshz3	APN	7	36769960	missense	probably damaging	0.97
IGL01922:Tshz3	APN	7	36769605	missense	probably damaging	1.00
IGL02047:Tshz3	APN	7	36770468	missense	probably damaging	1.00
IGL02166:Tshz3	APN	7	36768921	missense	probably benign	0.00
IGL02405:Tshz3	APN	7	36769650	missense	possibly damaging	0.93
IGL02658:Tshz3	APN	7	36769158	missense	probably damaging	0.99
IGL02968:Tshz3	APN	7	36769824	missense	probably damaging	1.00
IGL03073:Tshz3	APN	7	36770745	missense	probably damaging	1.00
IGL03233:Tshz3	APN	7	36770079	missense	probably damaging	0.97
IGL03296:Tshz3	APN	7	36771336	missense	probably damaging	1.00
R0049:Tshz3	UTSW	7	36770109	missense	probably damaging	1.00
R0049:Tshz3	UTSW	7	36770109	missense	probably damaging	1.00
R0090:Tshz3	UTSW	7	36768892	missense	probably benign
R0329:Tshz3	UTSW	7	36770033	missense	probably benign
R0330:Tshz3	UTSW	7	36770033	missense	probably benign
R0360:Tshz3	UTSW	7	36770533	missense	probably benign
R0364:Tshz3	UTSW	7	36770533	missense	probably benign
R0380:Tshz3	UTSW	7	36771300	missense	probably damaging	1.00
R0547:Tshz3	UTSW	7	36771417	missense	probably damaging	1.00
R1618:Tshz3	UTSW	7	36771796	missense	probably damaging	1.00
R1704:Tshz3	UTSW	7	36771360	missense	possibly damaging	0.92
R1881:Tshz3	UTSW	7	36771654	missense	possibly damaging	0.87
R1926:Tshz3	UTSW	7	36769375	missense	probably damaging	1.00
R1994:Tshz3	UTSW	7	36769822	missense	probably damaging	0.99
R2404:Tshz3	UTSW	7	36770380	missense	probably damaging	0.99
R2447:Tshz3	UTSW	7	36768753	missense	probably benign	0.00
R2930:Tshz3	UTSW	7	36771592	missense	possibly damaging	0.74
R3879:Tshz3	UTSW	7	36771537	nonsense	probably null
R4033:Tshz3	UTSW	7	36770584	missense	possibly damaging	0.71
R4212:Tshz3	UTSW	7	36770119	missense	probably damaging	1.00
R4394:Tshz3	UTSW	7	36769605	missense	probably damaging	1.00
R4779:Tshz3	UTSW	7	36768972	missense	probably damaging	1.00
R4977:Tshz3	UTSW	7	36771190	missense	probably benign	0.31
R5139:Tshz3	UTSW	7	36771025	missense	probably benign	0.23
R5448:Tshz3	UTSW	7	36771229	missense	possibly damaging	0.90
R5516:Tshz3	UTSW	7	36770350	missense	probably benign	0.03
R5760:Tshz3	UTSW	7	36771569	missense	probably damaging	1.00
R6360:Tshz3	UTSW	7	36769441	missense	probably damaging	1.00
R6481:Tshz3	UTSW	7	36752339	intron	probably null
R6535:Tshz3	UTSW	7	36768789	missense	probably damaging	1.00
R7105:Tshz3	UTSW	7	36769756	missense	probably damaging	1.00
R7133:Tshz3	UTSW	7	36770569	missense	probably benign	0.12
R7225:Tshz3	UTSW	7	36769657	missense	probably damaging	1.00
R7238:Tshz3	UTSW	7	36770097	missense	probably damaging	1.00
R7851:Tshz3	UTSW	7	36771589	missense	probably damaging	1.00
R7934:Tshz3	UTSW	7	36771589	missense	probably damaging	1.00
X0067:Tshz3	UTSW	7	36768796	missense	probably benign	0.19
X0067:Tshz3	UTSW	7	36769321	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGCCACCTTCCCAAGAGTCAAG -3'
(R):5'- TCATCTGCTCCAGGCTATCAGACAC -3'

Sequencing Primer
(F):5'- GAACGTATTCTAGGTACAATCCAC -3'
(R):5'- ATCAGACACGATGGTGTCCTC -3'

Posted On

2014-01-05