Incidental Mutation 'R1061:Olfr544'
ID 94476
Institutional Source Beutler Lab
Gene Symbol Olfr544
Ensembl Gene ENSMUSG00000043925
Gene Name olfactory receptor 544
Synonyms GA_x6K02T2PBJ9-5206624-5205620, MOR42-3
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 102482031-102488313 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 102484114 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Cysteine at position 335 (*335C)
Ref Sequence ENSEMBL: ENSMUSP00000051280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051201] [ENSMUST00000219647]
AlphaFold E9PX47
Predicted Effect probably null
Transcript: ENSMUST00000051201
AA Change: *335C
SMART Domains Protein: ENSMUSP00000051280
Gene: ENSMUSG00000043925
AA Change: *335C

Pfam:7tm_4 35 314 1.2e-73 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.3e-8 PFAM
Pfam:7tm_1 45 296 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219647
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Olfr544
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Olfr544 APN 7 102484478 missense probably damaging 1.00
IGL01380:Olfr544 APN 7 102484385 missense probably damaging 1.00
IGL01594:Olfr544 APN 7 102485047 missense probably benign
R0732:Olfr544 UTSW 7 102484443 missense probably benign 0.15
R1387:Olfr544 UTSW 7 102484704 missense probably benign 0.01
R2760:Olfr544 UTSW 7 102484376 missense probably damaging 1.00
R5151:Olfr544 UTSW 7 102484985 missense probably benign 0.00
R5916:Olfr544 UTSW 7 102484379 missense probably damaging 1.00
R6084:Olfr544 UTSW 7 102484389 missense probably damaging 1.00
R7069:Olfr544 UTSW 7 102484772 missense possibly damaging 0.85
R7195:Olfr544 UTSW 7 102484367 missense probably damaging 1.00
R7738:Olfr544 UTSW 7 102484611 missense probably damaging 0.99
R8299:Olfr544 UTSW 7 102484202 missense probably benign 0.01
R8433:Olfr544 UTSW 7 102484784 missense probably benign 0.00
R9063:Olfr544 UTSW 7 102484724 missense probably damaging 0.98
R9396:Olfr544 UTSW 7 102484973 missense possibly damaging 0.95
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agcatttggcaaactaagaaagg -3'
Posted On 2014-01-05