Incidental Mutation 'R1061:Zfp629'
ID 94478
Institutional Source Beutler Lab
Gene Symbol Zfp629
Ensembl Gene ENSMUSG00000045639
Gene Name zinc finger protein 629
Synonyms
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127607031-127615797 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 127611989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 216 (W216L)
Ref Sequence ENSEMBL: ENSMUSP00000113903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058038] [ENSMUST00000084564] [ENSMUST00000122066] [ENSMUST00000128731] [ENSMUST00000131318] [ENSMUST00000132524] [ENSMUST00000134446] [ENSMUST00000151107] [ENSMUST00000152315]
AlphaFold Q6A085
Predicted Effect probably damaging
Transcript: ENSMUST00000058038
AA Change: W216L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053760
Gene: ENSMUSG00000045639
AA Change: W216L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084564
AA Change: W216L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081612
Gene: ENSMUSG00000045639
AA Change: W216L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122066
AA Change: W216L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113903
Gene: ENSMUSG00000045639
AA Change: W216L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
ZnF_C2H2 233 255 2.99e-4 SMART
ZnF_C2H2 261 283 1.45e-2 SMART
ZnF_C2H2 289 311 1.13e-4 SMART
ZnF_C2H2 317 339 9.88e-5 SMART
ZnF_C2H2 345 367 9.73e-4 SMART
ZnF_C2H2 373 395 9.22e-5 SMART
ZnF_C2H2 401 423 6.08e-5 SMART
ZnF_C2H2 429 451 7.78e-3 SMART
ZnF_C2H2 457 479 3.95e-4 SMART
ZnF_C2H2 485 507 1.15e-5 SMART
ZnF_C2H2 513 535 2.91e-2 SMART
ZnF_C2H2 568 590 9.58e-3 SMART
ZnF_C2H2 661 683 3.16e-3 SMART
ZnF_C2H2 713 735 9.73e-4 SMART
low complexity region 737 754 N/A INTRINSIC
ZnF_C2H2 766 788 2.57e-3 SMART
ZnF_C2H2 840 862 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128731
SMART Domains Protein: ENSMUSP00000140505
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131318
AA Change: W216L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116375
Gene: ENSMUSG00000045639
AA Change: W216L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 199 2.09e-3 SMART
ZnF_C2H2 205 227 6.08e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132524
Predicted Effect probably benign
Transcript: ENSMUST00000134446
Predicted Effect probably benign
Transcript: ENSMUST00000151107
Predicted Effect probably benign
Transcript: ENSMUST00000152315
SMART Domains Protein: ENSMUSP00000114772
Gene: ENSMUSG00000045639

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
low complexity region 93 104 N/A INTRINSIC
ZnF_C2H2 149 171 4.01e-5 SMART
ZnF_C2H2 177 195 1.24e2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Other mutations in Zfp629
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Zfp629 APN 7 127612724 missense probably damaging 0.97
IGL01541:Zfp629 APN 7 127612745 utr 5 prime probably benign
IGL02116:Zfp629 APN 7 127612718 missense probably damaging 1.00
IGL02134:Zfp629 APN 7 127611870 missense probably benign 0.22
IGL02547:Zfp629 APN 7 127611674 splice site probably null
IGL02858:Zfp629 APN 7 127610312 missense probably damaging 1.00
IGL02867:Zfp629 APN 7 127610031 unclassified probably benign
IGL02889:Zfp629 APN 7 127610031 unclassified probably benign
R6768_Zfp629_044 UTSW 7 127610825 missense probably benign 0.03
R0020:Zfp629 UTSW 7 127611169 missense probably benign 0.02
R0137:Zfp629 UTSW 7 127611686 missense probably damaging 1.00
R0219:Zfp629 UTSW 7 127612083 missense probably damaging 1.00
R1182:Zfp629 UTSW 7 127610102 missense probably damaging 1.00
R1187:Zfp629 UTSW 7 127610229 missense probably benign
R1187:Zfp629 UTSW 7 127611887 missense probably damaging 1.00
R1217:Zfp629 UTSW 7 127612744 start gained probably benign
R1507:Zfp629 UTSW 7 127611861 nonsense probably null
R1526:Zfp629 UTSW 7 127610759 missense possibly damaging 0.69
R1622:Zfp629 UTSW 7 127611840 missense probably damaging 1.00
R1704:Zfp629 UTSW 7 127610864 missense probably benign 0.06
R1918:Zfp629 UTSW 7 127612000 missense probably damaging 1.00
R2147:Zfp629 UTSW 7 127610444 missense probably damaging 1.00
R2156:Zfp629 UTSW 7 127612379 missense probably benign 0.00
R2258:Zfp629 UTSW 7 127611791 missense probably damaging 1.00
R2994:Zfp629 UTSW 7 127611056 missense probably damaging 0.99
R3735:Zfp629 UTSW 7 127612778 splice site probably benign
R4287:Zfp629 UTSW 7 127611938 missense probably damaging 1.00
R4610:Zfp629 UTSW 7 127612320 missense probably benign 0.26
R4758:Zfp629 UTSW 7 127610586 missense probably damaging 1.00
R4899:Zfp629 UTSW 7 127611018 missense possibly damaging 0.69
R4922:Zfp629 UTSW 7 127612127 missense probably damaging 1.00
R5414:Zfp629 UTSW 7 127611282 missense probably damaging 0.97
R5772:Zfp629 UTSW 7 127611135 missense probably damaging 1.00
R5907:Zfp629 UTSW 7 127610370 missense probably damaging 1.00
R6768:Zfp629 UTSW 7 127610825 missense probably benign 0.03
R7122:Zfp629 UTSW 7 127611312 missense probably damaging 0.99
R7156:Zfp629 UTSW 7 127612291 nonsense probably null
R7407:Zfp629 UTSW 7 127610243 missense probably benign
R7446:Zfp629 UTSW 7 127611029 missense probably benign 0.00
R7780:Zfp629 UTSW 7 127612429 missense probably benign 0.12
R7871:Zfp629 UTSW 7 127611995 missense probably damaging 1.00
R8542:Zfp629 UTSW 7 127611192 nonsense probably null
R9095:Zfp629 UTSW 7 127610375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATGAAACTCTTGCCGCACTC -3'
(R):5'- CTGGAACAGCACACCTGTAGTCAC -3'

Sequencing Primer
(F):5'- TGCAGCGATAGGGCTTCTC -3'
(R):5'- ATCTGCAACGAGTGTGGC -3'
Posted On 2014-01-05