Mutagenetix > Incidental Mutations

Incidental Mutation 'R1061:Slc5a5'

94483

Institutional Source

Beutler Lab

Gene Symbol

Slc5a5

Ensembl Gene

ENSMUSG00000000792

Gene Name

solute carrier family 5 (sodium iodide symporter), member 5

Synonyms

NIS

MMRRC Submission

039147-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1061 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70882889-70892757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 70890221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 232 (M232L)

Ref Sequence

ENSEMBL: ENSMUSP00000000809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000809] [ENSMUST00000054220]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000000809
AA Change: M232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: M232L

Domain	Start	End	E-Value	Type
Pfam:SSF	47	452	2.5e-43	PFAM
transmembrane domain	522	544	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000054220

SMART Domains

Protein: ENSMUSP00000058368
Gene: ENSMUSG00000045128

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L18ae	7	130	1.4e-59	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,277,809	A715T	probably benign	Het
Ampd2	A	G	3: 108,075,689	Y641H	probably damaging	Het
Aqp4	A	T	18: 15,398,191	V171E	probably damaging	Het
Arid4a	T	A	12: 71,074,955	S381R	probably damaging	Het
Armc8	T	G	9: 99,537,731	N51H	probably damaging	Het
Asic5	T	A	3: 82,021,001	Y424N	probably damaging	Het
Bcl11a	A	T	11: 24,164,069	K471*	probably null	Het
Birc6	A	G	17: 74,689,312	T4494A	probably damaging	Het
Btbd9	A	G	17: 30,527,435	I139T	probably benign	Het
Ccdc114	T	C	7: 45,941,755	I218T	probably damaging	Het
Ccdc60	C	A	5: 116,172,468	R178S	possibly damaging	Het
Cd163	C	T	6: 124,309,169	A226V	probably benign	Het
Cog1	T	G	11: 113,652,037	S170A	probably benign	Het
Cwc15	T	C	9: 14,507,915	L169P	probably damaging	Het
Cyp3a25	A	T	5: 145,986,833	D333E	probably benign	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Dlc1	T	A	8: 36,858,051	T367S	probably benign	Het
Dnah17	T	C	11: 118,052,688	D3183G	possibly damaging	Het
Eif2a	T	A	3: 58,545,065	Y165*	probably null	Het
Eml6	T	C	11: 29,777,267	D1285G	probably damaging	Het
Fam92b	C	A	8: 120,169,704		probably null	Het
Fasn	T	C	11: 120,822,182		probably null	Het
Fbn1	T	C	2: 125,345,963	T1549A	probably benign	Het
Fezf2	T	C	14: 12,342,713	Y384C	probably damaging	Het
Flvcr1	A	T	1: 191,008,173	V550E	probably benign	Het
Gcm2	A	G	13: 41,105,871	W41R	probably damaging	Het
Gli2	A	T	1: 118,854,517	M160K	possibly damaging	Het
Gpr61	C	T	3: 108,150,307	R346H	probably damaging	Het
Hoxa5	A	T	6: 52,204,155	S66T	probably benign	Het
Hsph1	A	T	5: 149,618,418	V781D	possibly damaging	Het
Kdm3b	G	A	18: 34,796,862	V220M	probably damaging	Het
Klhl25	T	A	7: 75,866,520	Y391*	probably null	Het
Mc2r	A	T	18: 68,407,809	Y138N	probably damaging	Het
Mtap	C	A	4: 89,156,584	D106E	probably benign	Het
Nup43	G	T	10: 7,667,671	W37L	probably damaging	Het
Nxpe2	T	A	9: 48,326,363	E197D	probably damaging	Het
Olfr1098	A	T	2: 86,922,782	V250D	possibly damaging	Het
Olfr484	T	C	7: 108,124,456	Y269C	probably damaging	Het
Olfr544	T	A	7: 102,484,114	*335C	probably null	Het
Olfr934	C	A	9: 38,982,483	C187F	probably damaging	Het
Pitrm1	A	G	13: 6,555,575	H186R	probably damaging	Het
Pklr	C	T	3: 89,144,881	R467C	probably damaging	Het
Plxna2	A	G	1: 194,644,093	N112D	probably damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp3cb	A	C	14: 20,508,614		probably null	Het
R3hcc1l	C	T	19: 42,583,426	R135*	probably null	Het
Ralyl	A	C	3: 14,115,701	D68A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
S100a1	T	C	3: 90,511,312	N65S	probably damaging	Het
Scn11a	A	T	9: 119,795,663	M531K	probably damaging	Het
Tet3	A	T	6: 83,373,323	N1054K	probably damaging	Het
Tg	A	G	15: 66,698,559	N1427D	probably benign	Het
Tns1	A	C	1: 73,917,672	V530G	probably damaging	Het
Trcg1	C	A	9: 57,245,873	Q600K	possibly damaging	Het
Tshz3	A	G	7: 36,768,706	E40G	probably damaging	Het
Usp34	T	C	11: 23,384,420	F1138S	possibly damaging	Het
Vmn2r26	C	T	6: 124,061,644	T726I	probably benign	Het
Vmn2r97	A	T	17: 18,928,178	R112*	probably null	Het
Vwa2	G	T	19: 56,908,994	R577L	probably benign	Het
Vwa3b	A	C	1: 37,157,430	Q46P	probably damaging	Het
Wdr25	T	A	12: 108,992,799		probably null	Het
Wrap53	A	G	11: 69,562,400	L405P	probably damaging	Het
Zfp629	C	A	7: 127,611,989	W216L	probably damaging	Het

Other mutations in Slc5a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Slc5a5	APN	8	70888537	missense	probably damaging	0.99
IGL01372:Slc5a5	APN	8	70890376	unclassified	probably benign
IGL01394:Slc5a5	APN	8	70889388	nonsense	probably null
IGL01571:Slc5a5	APN	8	70891332	unclassified	probably benign
IGL02043:Slc5a5	APN	8	70892429	missense	possibly damaging	0.84
IGL02186:Slc5a5	APN	8	70886120	missense	possibly damaging	0.79
IGL02479:Slc5a5	APN	8	70888911	missense	possibly damaging	0.67
IGL02559:Slc5a5	APN	8	70890271	missense	probably damaging	1.00
IGL02892:Slc5a5	APN	8	70892517	missense	probably damaging	1.00
IGL03388:Slc5a5	APN	8	70890328	missense	probably benign	0.45
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0413:Slc5a5	UTSW	8	70891675	missense	possibly damaging	0.63
R0662:Slc5a5	UTSW	8	70883875	missense	probably benign	0.01
R0781:Slc5a5	UTSW	8	70890220	missense	probably benign	0.19
R1400:Slc5a5	UTSW	8	70889435	missense	possibly damaging	0.87
R1524:Slc5a5	UTSW	8	70892334	missense	probably damaging	1.00
R2033:Slc5a5	UTSW	8	70888587	missense	probably damaging	0.99
R2072:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2075:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2110:Slc5a5	UTSW	8	70889751	splice site	probably null
R2111:Slc5a5	UTSW	8	70889751	splice site	probably null
R2112:Slc5a5	UTSW	8	70889751	splice site	probably null
R2201:Slc5a5	UTSW	8	70892458	missense	probably damaging	0.98
R3978:Slc5a5	UTSW	8	70889395	missense	probably benign	0.00
R4244:Slc5a5	UTSW	8	70890286	missense	probably benign
R5161:Slc5a5	UTSW	8	70888848	missense	probably damaging	1.00
R5397:Slc5a5	UTSW	8	70891179	missense	probably damaging	1.00
R5718:Slc5a5	UTSW	8	70887755	missense	probably benign	0.00
R5740:Slc5a5	UTSW	8	70888917	splice site	probably null
R5869:Slc5a5	UTSW	8	70892330	missense	probably damaging	1.00
R6268:Slc5a5	UTSW	8	70888620	missense	probably damaging	1.00
R6290:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R6292:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R7098:Slc5a5	UTSW	8	70888538	missense	probably damaging	0.99
R7354:Slc5a5	UTSW	8	70889603	missense	probably damaging	1.00
R8777:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8777-TAIL:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8903:Slc5a5	UTSW	8	70892583	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAACCATGTGAGGATGTCACCC -3'
(R):5'- TCACAGATGTGCCACAGGAAGC -3'

Sequencing Primer
(F):5'- AGGATGTCACCCTCCCCAG -3'
(R):5'- GGTTTGTGACCTGTATCCCC -3'

Posted On

2014-01-05