Incidental Mutation 'R1061:Nxpe2'
ID 94490
Institutional Source Beutler Lab
Gene Symbol Nxpe2
Ensembl Gene ENSMUSG00000032028
Gene Name neurexophilin and PC-esterase domain family, member 2
Synonyms
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 48318006-48353454 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48326363 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 197 (E197D)
Ref Sequence ENSEMBL: ENSMUSP00000034527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034527] [ENSMUST00000135457] [ENSMUST00000137976] [ENSMUST00000215780] [ENSMUST00000216998]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034527
AA Change: E197D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034527
Gene: ENSMUSG00000032028
AA Change: E197D

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 80 277 1.2e-18 PFAM
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135457
Predicted Effect probably benign
Transcript: ENSMUST00000137976
SMART Domains Protein: ENSMUSP00000116684
Gene: ENSMUSG00000032028

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 99 187 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149185
Predicted Effect probably benign
Transcript: ENSMUST00000215780
Predicted Effect probably benign
Transcript: ENSMUST00000216998
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Nxpe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Nxpe2 APN 9 48320623 missense probably benign 0.00
IGL01830:Nxpe2 APN 9 48326494 missense probably damaging 1.00
IGL02039:Nxpe2 APN 9 48319659 missense probably benign 0.11
IGL02618:Nxpe2 APN 9 48326334 missense probably damaging 1.00
IGL03065:Nxpe2 APN 9 48319692 missense possibly damaging 0.68
IGL03128:Nxpe2 APN 9 48319498 missense probably benign 0.12
P4717OSA:Nxpe2 UTSW 9 48326377 missense probably benign 0.08
R0019:Nxpe2 UTSW 9 48319780 missense probably benign 0.37
R0172:Nxpe2 UTSW 9 48319909 missense possibly damaging 0.76
R0255:Nxpe2 UTSW 9 48340570 critical splice donor site probably null
R0415:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1248:Nxpe2 UTSW 9 48319911 missense possibly damaging 0.46
R1311:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1393:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1827:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1828:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1831:Nxpe2 UTSW 9 48326152 missense probably benign 0.01
R1866:Nxpe2 UTSW 9 48326821 missense probably benign 0.01
R1889:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1892:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1903:Nxpe2 UTSW 9 48319606 missense probably benign 0.40
R1928:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1959:Nxpe2 UTSW 9 48319726 missense probably benign 0.06
R4594:Nxpe2 UTSW 9 48319482 missense probably damaging 1.00
R4697:Nxpe2 UTSW 9 48320521 missense probably benign 0.03
R4909:Nxpe2 UTSW 9 48319597 missense possibly damaging 0.93
R5048:Nxpe2 UTSW 9 48326088 splice site probably null
R5372:Nxpe2 UTSW 9 48339519 missense possibly damaging 0.66
R5614:Nxpe2 UTSW 9 48323101 missense probably benign 0.30
R5762:Nxpe2 UTSW 9 48319575 missense probably benign 0.02
R6151:Nxpe2 UTSW 9 48326191 missense probably benign 0.01
R6958:Nxpe2 UTSW 9 48326266 missense probably damaging 1.00
R7130:Nxpe2 UTSW 9 48339537 missense probably benign 0.00
R7138:Nxpe2 UTSW 9 48320706 missense probably damaging 1.00
R7250:Nxpe2 UTSW 9 48326796 missense possibly damaging 0.77
R7289:Nxpe2 UTSW 9 48323039 critical splice donor site probably null
R7949:Nxpe2 UTSW 9 48323097 missense possibly damaging 0.83
R7973:Nxpe2 UTSW 9 48319868 missense probably damaging 0.99
R8327:Nxpe2 UTSW 9 48319759 missense probably benign 0.01
R8725:Nxpe2 UTSW 9 48326773 missense probably benign 0.01
R8727:Nxpe2 UTSW 9 48326773 missense probably benign 0.01
R9085:Nxpe2 UTSW 9 48339572 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCGAGCATCCAGATATTGACACAGC -3'
(R):5'- GCAGTCACAGCAATCCTGGAGAAG -3'

Sequencing Primer
(F):5'- TGACACAGCTCCGCACTTG -3'
(R):5'- GGCCAAGGACTATTTTGGTAAC -3'
Posted On 2014-01-05