Incidental Mutation 'R1061:Armc8'
ID94494
Institutional Source Beutler Lab
Gene Symbol Armc8
Ensembl Gene ENSMUSG00000032468
Gene Namearmadillo repeat containing 8
Synonyms1200015K23Rik, HSPC056, Gid5
MMRRC Submission 039147-MU
Accession Numbers

Genbank: NM_028768; MGI: 1921375

Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R1061 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99478372-99568899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 99537731 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 51 (N51H)
Ref Sequence ENSEMBL: ENSMUSP00000139973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035043] [ENSMUST00000185524] [ENSMUST00000186049]
Predicted Effect probably damaging
Transcript: ENSMUST00000035043
AA Change: N51H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: N51H

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
ARM 177 217 2.04e1 SMART
ARM 372 413 3.58e1 SMART
Blast:ARM 414 455 7e-17 BLAST
ARM 457 497 3.81e-1 SMART
ARM 500 540 5.43e1 SMART
Blast:ARM 542 585 1e-20 BLAST
Blast:ARM 633 673 1e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185524
AA Change: N51H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139973
Gene: ENSMUSG00000032468
AA Change: N51H

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
Blast:ARM 138 176 1e-5 BLAST
ARM 177 217 2.04e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186049
AA Change: N9H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140426
Gene: ENSMUSG00000032468
AA Change: N9H

DomainStartEndE-ValueType
ARM 8 50 8.5e-3 SMART
ARM 52 92 2.6e-2 SMART
Blast:ARM 96 134 7e-6 BLAST
ARM 135 175 9.8e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Armc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Armc8 APN 9 99505734 critical splice acceptor site probably null
IGL00951:Armc8 APN 9 99505704 missense probably benign 0.00
IGL01776:Armc8 APN 9 99526883 splice site probably benign
IGL02215:Armc8 APN 9 99483978 missense possibly damaging 0.92
IGL02244:Armc8 APN 9 99483174 missense probably benign 0.10
IGL02610:Armc8 APN 9 99527069 splice site probably benign
IGL02612:Armc8 APN 9 99527069 splice site probably benign
IGL02615:Armc8 APN 9 99527069 splice site probably benign
IGL02619:Armc8 APN 9 99527069 splice site probably benign
IGL02621:Armc8 APN 9 99527069 splice site probably benign
IGL02622:Armc8 APN 9 99527069 splice site probably benign
IGL02623:Armc8 APN 9 99527069 splice site probably benign
IGL02624:Armc8 APN 9 99527069 splice site probably benign
D4043:Armc8 UTSW 9 99483976 missense probably benign 0.13
R0321:Armc8 UTSW 9 99533177 missense probably damaging 0.99
R0498:Armc8 UTSW 9 99497292 missense probably damaging 1.00
R0646:Armc8 UTSW 9 99505688 missense probably damaging 1.00
R0658:Armc8 UTSW 9 99536158 splice site probably benign
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1429:Armc8 UTSW 9 99536207 missense possibly damaging 0.67
R1432:Armc8 UTSW 9 99523132 splice site probably benign
R1538:Armc8 UTSW 9 99505290 missense probably damaging 0.96
R1606:Armc8 UTSW 9 99537729 missense probably damaging 0.98
R1817:Armc8 UTSW 9 99536259 missense possibly damaging 0.67
R1866:Armc8 UTSW 9 99536280 missense probably benign
R2015:Armc8 UTSW 9 99483105 nonsense probably null
R2143:Armc8 UTSW 9 99505308 missense probably damaging 0.99
R2251:Armc8 UTSW 9 99502600 critical splice acceptor site probably null
R2842:Armc8 UTSW 9 99505681 missense probably benign
R3010:Armc8 UTSW 9 99487913 missense probably benign 0.06
R3709:Armc8 UTSW 9 99520497 missense probably damaging 1.00
R4440:Armc8 UTSW 9 99484034 missense probably benign 0.37
R4865:Armc8 UTSW 9 99526889 critical splice donor site probably null
R5492:Armc8 UTSW 9 99527131 nonsense probably null
R5606:Armc8 UTSW 9 99536262 missense probably benign 0.23
R5639:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5693:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5694:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5698:Armc8 UTSW 9 99535820 missense probably benign 0.12
R5700:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5701:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5735:Armc8 UTSW 9 99497394 critical splice acceptor site probably null
R6314:Armc8 UTSW 9 99535884 missense probably benign 0.28
R7034:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7036:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7393:Armc8 UTSW 9 99483999 missense possibly damaging 0.47
R7395:Armc8 UTSW 9 99533132 missense probably damaging 0.99
Z1177:Armc8 UTSW 9 99497386 missense not run
Predicted Primers PCR Primer
(F):5'- TGAGCCACTTGCCAAAGAACTACTC -3'
(R):5'- AGCCAGTTAGCACCTGTCACTGTC -3'

Sequencing Primer
(F):5'- GGCTTCCTAAGCACACTCG -3'
(R):5'- TCTTTAGCACTCTGGCTGC -3'
Posted On2014-01-05