Incidental Mutation 'R1061:Scn11a'
ID94498
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R1061 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119795663 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 531 (M531K)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: M531K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: M531K

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: M531K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTCTCAGGAAAGCCCATTTCAG -3'
(R):5'- TGATCCGCCATTATGACGCTGC -3'

Sequencing Primer
(F):5'- AGTCAAACTACTCTGCTTGCG -3'
(R):5'- CGGACCTCTCCGTATAAAGTG -3'
Posted On2014-01-05