Incidental Mutation 'R1061:Nup43'
ID94499
Institutional Source Beutler Lab
Gene Symbol Nup43
Ensembl Gene ENSMUSG00000040034
Gene Namenucleoporin 43
Synonymsp42, 43kDa, 2610529I12Rik, 2610016K01Rik
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1061 (G1)
Quality Score162
Status Not validated
Chromosome10
Chromosomal Location7667503-7678881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7667671 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 37 (W37L)
Ref Sequence ENSEMBL: ENSMUSP00000046732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040135] [ENSMUST00000159917] [ENSMUST00000159977] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000162682] [ENSMUST00000163085]
Predicted Effect probably damaging
Transcript: ENSMUST00000040135
AA Change: W37L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046732
Gene: ENSMUSG00000040034
AA Change: W37L

DomainStartEndE-ValueType
Blast:WD40 1 48 1e-15 BLAST
WD40 64 101 3.57e0 SMART
WD40 124 157 2.45e2 SMART
WD40 160 199 9.55e0 SMART
WD40 206 246 2.15e-4 SMART
WD40 250 290 2.19e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159917
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161060
Predicted Effect probably benign
Transcript: ENSMUST00000161123
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162527
Predicted Effect probably benign
Transcript: ENSMUST00000162606
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163085
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP43 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Nup43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Nup43 APN 10 7669556 missense probably benign
IGL02029:Nup43 APN 10 7667583 missense possibly damaging 0.87
IGL02375:Nup43 APN 10 7673594 missense probably damaging 1.00
R0413:Nup43 UTSW 10 7671027 missense probably benign 0.05
R1892:Nup43 UTSW 10 7673609 missense probably damaging 0.99
R2960:Nup43 UTSW 10 7670949 missense probably benign
R3551:Nup43 UTSW 10 7675014 missense possibly damaging 0.93
R4772:Nup43 UTSW 10 7678669 nonsense probably null
R6179:Nup43 UTSW 10 7678673 missense probably benign 0.40
R6346:Nup43 UTSW 10 7675062 missense probably damaging 1.00
R8073:Nup43 UTSW 10 7670949 missense probably benign
R8220:Nup43 UTSW 10 7676333 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCAGTGTGCTTTCTGCTGAAC -3'
(R):5'- GGCGACCTTGCTTCAATAGCATCTC -3'

Sequencing Primer
(F):5'- TGCTGAACCTTCTTGCTGG -3'
(R):5'- TTTGGACGGTATGACTACAGAC -3'
Posted On2014-01-05