Incidental Mutation 'R1061:Ddc'
Institutional Source Beutler Lab
Gene Symbol Ddc
Ensembl Gene ENSMUSG00000020182
Gene Namedopa decarboxylase
SynonymsAadc, aromatic L-amino acid decarboxylase
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1061 (G1)
Quality Score225
Status Not validated
Chromosomal Location11814101-11898144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11829132 bp
Amino Acid Change Valine to Isoleucine at position 331 (V331I)
Ref Sequence ENSEMBL: ENSMUSP00000136467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066237] [ENSMUST00000109659] [ENSMUST00000178704]
Predicted Effect probably benign
Transcript: ENSMUST00000066237
AA Change: V331I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000068525
Gene: ENSMUSG00000020182
AA Change: V331I

Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109659
AA Change: V331I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105286
Gene: ENSMUSG00000020182
AA Change: V331I

Pfam:Pyridoxal_deC 35 414 4.8e-174 PFAM
Pfam:Beta_elim_lyase 82 403 4.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134401
Predicted Effect probably benign
Transcript: ENSMUST00000178704
AA Change: V331I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136467
Gene: ENSMUSG00000020182
AA Change: V331I

Pfam:Pyridoxal_deC 35 414 8.2e-173 PFAM
Pfam:Beta_elim_lyase 81 401 2.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit preweaning phenotype. Mice homozygous for a different knock-in allele exhibit partial prenatal lethality, decreased body size, postnatal growth retardation, hypoactivity, increased anxiety, tremors, decreased heart rate and decreased dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Ddc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Ddc APN 11 11839462 missense probably damaging 1.00
IGL01336:Ddc APN 11 11846630 splice site probably null
IGL02257:Ddc APN 11 11873171 nonsense probably null
IGL02327:Ddc APN 11 11863739 missense probably damaging 0.98
IGL02516:Ddc APN 11 11829125 missense probably damaging 1.00
IGL02616:Ddc APN 11 11880645 utr 5 prime probably benign
IGL02888:Ddc APN 11 11822297 splice site probably benign
IGL03267:Ddc APN 11 11876303 missense probably damaging 1.00
R0454:Ddc UTSW 11 11880587 missense possibly damaging 0.88
R1173:Ddc UTSW 11 11846634 critical splice donor site probably null
R1382:Ddc UTSW 11 11824856 missense possibly damaging 0.52
R1549:Ddc UTSW 11 11846656 splice site probably null
R1583:Ddc UTSW 11 11829131 missense probably benign 0.17
R1929:Ddc UTSW 11 11835764 missense probably damaging 1.00
R1970:Ddc UTSW 11 11815292 missense possibly damaging 0.87
R2034:Ddc UTSW 11 11880456 missense probably benign 0.40
R2270:Ddc UTSW 11 11835764 missense probably damaging 1.00
R2272:Ddc UTSW 11 11835764 missense probably damaging 1.00
R4449:Ddc UTSW 11 11835802 missense probably damaging 1.00
R4508:Ddc UTSW 11 11819393 critical splice acceptor site probably null
R4799:Ddc UTSW 11 11846632 splice site probably null
R5307:Ddc UTSW 11 11876321 missense probably damaging 1.00
R6654:Ddc UTSW 11 11880452 missense probably damaging 1.00
R6817:Ddc UTSW 11 11824854 missense probably damaging 1.00
R6918:Ddc UTSW 11 11819307 missense probably damaging 1.00
R7001:Ddc UTSW 11 11824870 critical splice acceptor site probably null
R7784:Ddc UTSW 11 11839396 critical splice donor site probably null
R8435:Ddc UTSW 11 11864902 missense probably damaging 0.97
R8550:Ddc UTSW 11 11835743 missense probably damaging 1.00
Z1177:Ddc UTSW 11 11880552 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccttccagccttttcttttc -3'
Posted On2014-01-05