Incidental Mutation 'R1061:Fasn'
ID94514
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1061 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationunclassified (590 bp from exon)
DNA Base Change (assembly) T to C at 120822182 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000056781] [ENSMUST00000205905] [ENSMUST00000206589]
Predicted Effect probably benign
Transcript: ENSMUST00000055655
AA Change: K59R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: K59R

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000056781
SMART Domains Protein: ENSMUSP00000050996
Gene: ENSMUSG00000048445

DomainStartEndE-ValueType
coiled coil region 14 174 N/A INTRINSIC
coiled coil region 198 350 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
coiled coil region 380 489 N/A INTRINSIC
coiled coil region 519 548 N/A INTRINSIC
coiled coil region 575 607 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
internal_repeat_1 657 677 1.17e-5 PROSPERO
low complexity region 763 774 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
internal_repeat_1 863 883 1.17e-5 PROSPERO
low complexity region 915 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150640
Predicted Effect probably null
Transcript: ENSMUST00000205905
Predicted Effect probably benign
Transcript: ENSMUST00000206589
AA Change: K59R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0389:Fasn UTSW 11 120816182 missense probably damaging 1.00
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1109:Fasn UTSW 11 120812324 missense possibly damaging 0.77
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5728:Fasn UTSW 11 120813513 missense probably benign 0.06
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6742:Fasn UTSW 11 120810453 missense probably damaging 0.96
R6767:Fasn UTSW 11 120817487 missense possibly damaging 0.62
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
R7157:Fasn UTSW 11 120810465 nonsense probably null
R7373:Fasn UTSW 11 120813976 missense possibly damaging 0.81
R7575:Fasn UTSW 11 120812687 missense possibly damaging 0.93
R7652:Fasn UTSW 11 120816328 missense probably damaging 0.97
R7670:Fasn UTSW 11 120813419 missense probably damaging 1.00
R7806:Fasn UTSW 11 120809995 missense probably benign 0.00
R8007:Fasn UTSW 11 120809527 missense probably benign
R8012:Fasn UTSW 11 120811602 missense probably damaging 1.00
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Z1177:Fasn UTSW 11 120815471 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGCCCTTGATGTCTCAAGAGCC -3'
(R):5'- AGCTCTACCTGATGGACAGGTGTG -3'

Sequencing Primer
(F):5'- cagtaccaggaatgaagtccag -3'
(R):5'- ACAGGTGTGAGTCAGCATTG -3'
Posted On2014-01-05