Incidental Mutation 'R1133:B430305J03Rik'
ID94517
Institutional Source Beutler Lab
Gene Symbol B430305J03Rik
Ensembl Gene ENSMUSG00000053706
Gene NameRIKEN cDNA B430305J03 gene
Synonyms
MMRRC Submission 039206-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.593) question?
Stock #R1133 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location61362250-61365951 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 61364009 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 105 (W105*)
Ref Sequence ENSEMBL: ENSMUSP00000070175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049064] [ENSMUST00000066298]
Predicted Effect probably benign
Transcript: ENSMUST00000049064
SMART Domains Protein: ENSMUSP00000038841
Gene: ENSMUSG00000036894

DomainStartEndE-ValueType
RAS 1 167 3.08e-111 SMART
Predicted Effect probably null
Transcript: ENSMUST00000066298
AA Change: W105*
SMART Domains Protein: ENSMUSP00000070175
Gene: ENSMUSG00000053706
AA Change: W105*

DomainStartEndE-ValueType
low complexity region 95 103 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194223
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahr A G 12: 35,526,806 L42P probably damaging Het
Gpr156 T A 16: 38,005,321 N633K probably benign Het
Hook2 T C 8: 84,995,804 L324P probably damaging Het
Olfr147 A T 9: 38,403,731 M283L probably benign Het
Socs4 A G 14: 47,290,194 I195M probably benign Het
Syne1 A G 10: 5,349,044 I1014T possibly damaging Het
Ttc30a2 G A 2: 75,977,383 Q262* probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Other mutations in B430305J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:B430305J03Rik APN 3 61364141 utr 5 prime probably benign
R0400:B430305J03Rik UTSW 3 61364135 utr 5 prime probably benign
R0704:B430305J03Rik UTSW 3 61363993 nonsense probably null
R1727:B430305J03Rik UTSW 3 61363878 utr 5 prime probably benign
R1735:B430305J03Rik UTSW 3 61363940 utr 5 prime probably benign
R4065:B430305J03Rik UTSW 3 61364225 utr 5 prime probably benign
R4978:B430305J03Rik UTSW 3 61364019 start gained probably benign
R7073:B430305J03Rik UTSW 3 61364260 missense unknown
R7242:B430305J03Rik UTSW 3 61363835 missense unknown
R7345:B430305J03Rik UTSW 3 61364118 missense unknown
Predicted Primers PCR Primer
(F):5'- GCGACTTTGCAGCCAATGAAGC -3'
(R):5'- AGGATAGACACTTGTCCCCGAACTC -3'

Sequencing Primer
(F):5'- CCAATGAAGCTGTCTAAAGCG -3'
(R):5'- GCCTCTCAGGATCGTACAC -3'
Posted On2014-01-05