Mutagenetix > Incidental Mutations

Incidental Mutation 'R1061:Arid4a'

94518

Institutional Source

Beutler Lab

Gene Symbol

Arid4a

Ensembl Gene

ENSMUSG00000048118

Gene Name

AT rich interactive domain 4A (RBP1-like)

Synonyms

Rbbp1, A630067N03Rik

MMRRC Submission

039147-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1061 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71015990-71098592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71074955 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 381 (S381R)

Ref Sequence

ENSEMBL: ENSMUSP00000121319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]

AlphaFold

F8VPQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000046305
AA Change: S703R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: S703R

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	3.6e-12	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	170	262	4e-32	PFAM
ARID	306	397	6.7e-37	SMART
BRIGHT	310	402	2.3e-40	SMART
low complexity region	411	422	N/A	INTRINSIC
CHROMO	483	652	6.8e-6	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	965	976	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC
coiled coil region	1185	1224	N/A	INTRINSIC
low complexity region	1229	1252	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000135709
AA Change: S381R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: S381R

Domain	Start	End	E-Value	Type
ARID	1	75	1.02e-16	SMART
BRIGHT	1	80	2.05e-23	SMART
low complexity region	89	100	N/A	INTRINSIC
CHROMO	161	330	1.08e-3	SMART
low complexity region	368	385	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,277,809	A715T	probably benign	Het
Ampd2	A	G	3: 108,075,689	Y641H	probably damaging	Het
Aqp4	A	T	18: 15,398,191	V171E	probably damaging	Het
Armc8	T	G	9: 99,537,731	N51H	probably damaging	Het
Asic5	T	A	3: 82,021,001	Y424N	probably damaging	Het
Bcl11a	A	T	11: 24,164,069	K471*	probably null	Het
Birc6	A	G	17: 74,689,312	T4494A	probably damaging	Het
Btbd9	A	G	17: 30,527,435	I139T	probably benign	Het
Ccdc114	T	C	7: 45,941,755	I218T	probably damaging	Het
Ccdc60	C	A	5: 116,172,468	R178S	possibly damaging	Het
Cd163	C	T	6: 124,309,169	A226V	probably benign	Het
Cog1	T	G	11: 113,652,037	S170A	probably benign	Het
Cwc15	T	C	9: 14,507,915	L169P	probably damaging	Het
Cyp3a25	A	T	5: 145,986,833	D333E	probably benign	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Dlc1	T	A	8: 36,858,051	T367S	probably benign	Het
Dnah17	T	C	11: 118,052,688	D3183G	possibly damaging	Het
Eif2a	T	A	3: 58,545,065	Y165*	probably null	Het
Eml6	T	C	11: 29,777,267	D1285G	probably damaging	Het
Fam92b	C	A	8: 120,169,704		probably null	Het
Fasn	T	C	11: 120,822,182		probably null	Het
Fbn1	T	C	2: 125,345,963	T1549A	probably benign	Het
Fezf2	T	C	14: 12,342,713	Y384C	probably damaging	Het
Flvcr1	A	T	1: 191,008,173	V550E	probably benign	Het
Gcm2	A	G	13: 41,105,871	W41R	probably damaging	Het
Gli2	A	T	1: 118,854,517	M160K	possibly damaging	Het
Gpr61	C	T	3: 108,150,307	R346H	probably damaging	Het
Hoxa5	A	T	6: 52,204,155	S66T	probably benign	Het
Hsph1	A	T	5: 149,618,418	V781D	possibly damaging	Het
Kdm3b	G	A	18: 34,796,862	V220M	probably damaging	Het
Klhl25	T	A	7: 75,866,520	Y391*	probably null	Het
Mc2r	A	T	18: 68,407,809	Y138N	probably damaging	Het
Mtap	C	A	4: 89,156,584	D106E	probably benign	Het
Nup43	G	T	10: 7,667,671	W37L	probably damaging	Het
Nxpe2	T	A	9: 48,326,363	E197D	probably damaging	Het
Olfr1098	A	T	2: 86,922,782	V250D	possibly damaging	Het
Olfr484	T	C	7: 108,124,456	Y269C	probably damaging	Het
Olfr544	T	A	7: 102,484,114	*335C	probably null	Het
Olfr934	C	A	9: 38,982,483	C187F	probably damaging	Het
Pitrm1	A	G	13: 6,555,575	H186R	probably damaging	Het
Pklr	C	T	3: 89,144,881	R467C	probably damaging	Het
Plxna2	A	G	1: 194,644,093	N112D	probably damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp3cb	A	C	14: 20,508,614		probably null	Het
R3hcc1l	C	T	19: 42,583,426	R135*	probably null	Het
Ralyl	A	C	3: 14,115,701	D68A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
S100a1	T	C	3: 90,511,312	N65S	probably damaging	Het
Scn11a	A	T	9: 119,795,663	M531K	probably damaging	Het
Slc5a5	T	A	8: 70,890,221	M232L	probably benign	Het
Tet3	A	T	6: 83,373,323	N1054K	probably damaging	Het
Tg	A	G	15: 66,698,559	N1427D	probably benign	Het
Tns1	A	C	1: 73,917,672	V530G	probably damaging	Het
Trcg1	C	A	9: 57,245,873	Q600K	possibly damaging	Het
Tshz3	A	G	7: 36,768,706	E40G	probably damaging	Het
Usp34	T	C	11: 23,384,420	F1138S	possibly damaging	Het
Vmn2r26	C	T	6: 124,061,644	T726I	probably benign	Het
Vmn2r97	A	T	17: 18,928,178	R112*	probably null	Het
Vwa2	G	T	19: 56,908,994	R577L	probably benign	Het
Vwa3b	A	C	1: 37,157,430	Q46P	probably damaging	Het
Wdr25	T	A	12: 108,992,799		probably null	Het
Wrap53	A	G	11: 69,562,400	L405P	probably damaging	Het
Zfp629	C	A	7: 127,611,989	W216L	probably damaging	Het

Other mutations in Arid4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Arid4a	APN	12	71072593	missense	probably damaging	1.00
IGL00546:Arid4a	APN	12	71075671	missense	probably benign
IGL00553:Arid4a	APN	12	71075977	missense	probably benign	0.04
IGL00708:Arid4a	APN	12	71072728	missense	probably benign	0.02
IGL00847:Arid4a	APN	12	71075718	missense	probably damaging	1.00
IGL01112:Arid4a	APN	12	71072733	critical splice donor site	probably null
IGL01456:Arid4a	APN	12	71067262	missense	probably benign	0.00
IGL01505:Arid4a	APN	12	71037115	missense	probably damaging	1.00
IGL01555:Arid4a	APN	12	71061527	splice site	probably benign
IGL01631:Arid4a	APN	12	71022262	splice site	probably benign
IGL02958:Arid4a	APN	12	71097563	missense	probably benign	0.01
IGL03087:Arid4a	APN	12	71075245	missense	possibly damaging	0.94
IGL03111:Arid4a	APN	12	71039966	missense	probably damaging	1.00
IGL03234:Arid4a	APN	12	71045060	missense	probably benign	0.34
After_8	UTSW	12	71023498	critical splice acceptor site	probably null
ariano	UTSW	12	71069860	nonsense	probably null
Dusty	UTSW	12	71060093	missense	probably damaging	1.00
guava	UTSW	12	71072632	missense	probably damaging	0.99
limoncello	UTSW	12	71067341	splice site	probably null
Sahara	UTSW	12	71060115	nonsense	probably null
Under_8	UTSW	12	71063206	missense	probably benign	0.10
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0270:Arid4a	UTSW	12	71072632	missense	probably damaging	0.99
R0310:Arid4a	UTSW	12	71075830	missense	probably benign	0.05
R0504:Arid4a	UTSW	12	71047214	missense	probably damaging	1.00
R1087:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1169:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1171:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1531:Arid4a	UTSW	12	71076005	missense	probably benign	0.01
R1674:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1676:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1768:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1833:Arid4a	UTSW	12	71075466	missense	possibly damaging	0.50
R1878:Arid4a	UTSW	12	71087589	missense	probably damaging	1.00
R2290:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2292:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R3411:Arid4a	UTSW	12	71061525	splice site	probably benign
R3768:Arid4a	UTSW	12	71067119	missense	probably damaging	1.00
R3838:Arid4a	UTSW	12	71075785	missense	possibly damaging	0.94
R4320:Arid4a	UTSW	12	71069995	missense	possibly damaging	0.69
R4589:Arid4a	UTSW	12	71069964	missense	probably damaging	1.00
R4829:Arid4a	UTSW	12	71023498	critical splice acceptor site	probably null
R4862:Arid4a	UTSW	12	71075947	missense	probably damaging	0.96
R4952:Arid4a	UTSW	12	71023525	missense	possibly damaging	0.64
R5072:Arid4a	UTSW	12	71045079	missense	probably benign	0.08
R5423:Arid4a	UTSW	12	71069860	nonsense	probably null
R5767:Arid4a	UTSW	12	71060093	missense	probably damaging	1.00
R5911:Arid4a	UTSW	12	71069973	missense	probably damaging	1.00
R5952:Arid4a	UTSW	12	71063206	missense	probably benign	0.10
R6088:Arid4a	UTSW	12	71022236	missense	probably damaging	0.99
R6235:Arid4a	UTSW	12	71069772	splice site	probably null
R6277:Arid4a	UTSW	12	71039891	missense	possibly damaging	0.49
R6455:Arid4a	UTSW	12	71075088	missense	probably benign	0.04
R6523:Arid4a	UTSW	12	71067341	splice site	probably null
R6701:Arid4a	UTSW	12	71087512	missense	probably damaging	1.00
R6812:Arid4a	UTSW	12	71047263	missense	possibly damaging	0.92
R6815:Arid4a	UTSW	12	71017082	splice site	probably null
R6837:Arid4a	UTSW	12	71075515	missense	probably benign
R6858:Arid4a	UTSW	12	71023509	missense	probably benign	0.01
R6895:Arid4a	UTSW	12	71063302	missense	probably benign	0.18
R6901:Arid4a	UTSW	12	71067137	missense	probably damaging	0.99
R6905:Arid4a	UTSW	12	71061544	missense	probably benign	0.43
R7387:Arid4a	UTSW	12	71087496	missense	probably damaging	1.00
R7570:Arid4a	UTSW	12	71063142	nonsense	probably null
R7772:Arid4a	UTSW	12	71061589	missense	possibly damaging	0.65
R8194:Arid4a	UTSW	12	71060115	nonsense	probably null
R8206:Arid4a	UTSW	12	71086587	missense	probably damaging	1.00
R8552:Arid4a	UTSW	12	71060075	missense	probably benign
R8696:Arid4a	UTSW	12	71063316	missense	probably damaging	1.00
R9015:Arid4a	UTSW	12	71075394	missense	possibly damaging	0.89
R9109:Arid4a	UTSW	12	71075355	missense	probably damaging	1.00
Z1176:Arid4a	UTSW	12	71039920	missense	possibly damaging	0.89
Z1177:Arid4a	UTSW	12	71075637	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CGCCACATTGCTCATTTTAATCCAGAC -3'
(R):5'- GCACAATTTGATCGCTGTCCCCTG -3'

Sequencing Primer
(F):5'- gctcagagatccacttgcc -3'
(R):5'- ACCGTCAGGGTGTCTGAG -3'

Posted On

2014-01-05