Incidental Mutation 'R1133:Ugt2b38'
ID94523
Institutional Source Beutler Lab
Gene Symbol Ugt2b38
Ensembl Gene ENSMUSG00000061906
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms
MMRRC Submission 039206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1133 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87409942-87424203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87412373 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 361 (N361H)
Ref Sequence ENSEMBL: ENSMUSP00000072598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072818]
Predicted Effect probably damaging
Transcript: ENSMUST00000072818
AA Change: N361H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072598
Gene: ENSMUSG00000061906
AA Change: N361H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 4.1e-255 PFAM
Pfam:Glyco_tran_28_C 330 444 1.2e-7 PFAM
Meta Mutation Damage Score 0.8618 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahr A G 12: 35,526,806 L42P probably damaging Het
B430305J03Rik C T 3: 61,364,009 W105* probably null Het
Gpr156 T A 16: 38,005,321 N633K probably benign Het
Hook2 T C 8: 84,995,804 L324P probably damaging Het
Olfr147 A T 9: 38,403,731 M283L probably benign Het
Socs4 A G 14: 47,290,194 I195M probably benign Het
Syne1 A G 10: 5,349,044 I1014T possibly damaging Het
Ttc30a2 G A 2: 75,977,383 Q262* probably null Het
Other mutations in Ugt2b38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ugt2b38 APN 5 87411823 missense probably damaging 1.00
IGL02326:Ugt2b38 APN 5 87423733 missense probably damaging 1.00
IGL02537:Ugt2b38 APN 5 87421731 missense possibly damaging 0.91
IGL02543:Ugt2b38 APN 5 87423483 missense probably benign 0.00
IGL02852:Ugt2b38 APN 5 87411741 missense probably benign
IGL03008:Ugt2b38 APN 5 87412423 missense probably benign 0.00
over_easy UTSW 5 87423742 missense probably benign 0.25
R0089:Ugt2b38 UTSW 5 87420558 missense probably benign 0.00
R0647:Ugt2b38 UTSW 5 87423469 missense probably benign 0.00
R0731:Ugt2b38 UTSW 5 87420452 missense probably damaging 1.00
R0837:Ugt2b38 UTSW 5 87411773 missense probably damaging 1.00
R0966:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0969:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0970:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0971:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1068:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1070:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1071:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1073:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1134:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1367:Ugt2b38 UTSW 5 87424114 missense probably benign 0.11
R1383:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1565:Ugt2b38 UTSW 5 87411914 missense probably damaging 0.99
R1691:Ugt2b38 UTSW 5 87424132 missense probably benign
R1725:Ugt2b38 UTSW 5 87411871 missense probably damaging 1.00
R1736:Ugt2b38 UTSW 5 87423633 missense probably benign
R2230:Ugt2b38 UTSW 5 87421668 missense probably benign 0.05
R2419:Ugt2b38 UTSW 5 87423732 missense probably damaging 1.00
R2496:Ugt2b38 UTSW 5 87421692 missense probably damaging 1.00
R3196:Ugt2b38 UTSW 5 87410219 missense probably damaging 0.96
R3773:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R5125:Ugt2b38 UTSW 5 87411812 missense probably damaging 1.00
R5224:Ugt2b38 UTSW 5 87423742 missense probably benign 0.25
R5516:Ugt2b38 UTSW 5 87411843 missense probably damaging 1.00
R5765:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R6352:Ugt2b38 UTSW 5 87424001 missense possibly damaging 0.73
R7166:Ugt2b38 UTSW 5 87410446 missense probably damaging 1.00
R7210:Ugt2b38 UTSW 5 87410425 missense probably damaging 0.99
R7291:Ugt2b38 UTSW 5 87411895 missense probably damaging 1.00
R7483:Ugt2b38 UTSW 5 87424114 missense probably damaging 0.96
R7969:Ugt2b38 UTSW 5 87424032 missense probably benign 0.02
R8118:Ugt2b38 UTSW 5 87423771 missense probably damaging 1.00
R8239:Ugt2b38 UTSW 5 87423800 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGGCCCCACCATGAGTTACAAAG -3'
(R):5'- GGCACACTCGTTGCTCAGTCTT -3'

Sequencing Primer
(F):5'- CTCTGTCTCAGAGCTAGAAGAATC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-01-05