Incidental Mutation 'R1061:Pitrm1'
ID 94526
Institutional Source Beutler Lab
Gene Symbol Pitrm1
Ensembl Gene ENSMUSG00000021193
Gene Name pitrilysin metallepetidase 1
Synonyms Ntup1, PreP, 2310012C15Rik, MP-1
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 6548149-6580515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6555575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 186 (H186R)
Ref Sequence ENSEMBL: ENSMUSP00000152229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021611] [ENSMUST00000221911] [ENSMUST00000222485]
AlphaFold Q8K411
Predicted Effect probably damaging
Transcript: ENSMUST00000021611
AA Change: H185R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021611
Gene: ENSMUSG00000021193
AA Change: H185R

DomainStartEndE-ValueType
Pfam:Peptidase_M16 93 188 1.8e-7 PFAM
Pfam:Peptidase_M16_C 244 431 4.7e-27 PFAM
M16C_associated 504 752 2.8e-114 SMART
Pfam:Peptidase_M16_C 771 958 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220454
Predicted Effect probably benign
Transcript: ENSMUST00000221120
Predicted Effect probably benign
Transcript: ENSMUST00000221911
Predicted Effect probably damaging
Transcript: ENSMUST00000222485
AA Change: H186R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATP-dependent metalloprotease that degrades post-cleavage mitochondrial transit peptides. The encoded protein binds zinc and can also degrade amyloid beta A4 protein, suggesting a possible role in Alzheimer's disease. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show complete preweaning lethality. Heterozygotes show progressive ataxia, neurodegeneration, and accumulation of amyloid beta deposits. Mitochondria show impaired degradation rate of amyloid beta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Pitrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pitrm1 APN 13 6568666 missense probably damaging 1.00
IGL01148:Pitrm1 APN 13 6573105 missense probably benign
IGL01408:Pitrm1 APN 13 6573042 missense probably damaging 1.00
IGL01557:Pitrm1 APN 13 6552684 missense probably benign 0.37
IGL01803:Pitrm1 APN 13 6579435 missense probably benign 0.00
IGL02111:Pitrm1 APN 13 6573145 missense probably benign 0.45
IGL02217:Pitrm1 APN 13 6567341 splice site probably benign
IGL02539:Pitrm1 APN 13 6568756 missense probably benign 0.26
IGL02935:Pitrm1 APN 13 6553264 missense probably damaging 1.00
IGL03028:Pitrm1 APN 13 6574393 missense probably benign 0.00
IGL03112:Pitrm1 APN 13 6565008 missense probably benign 0.10
FR4737:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
FR4976:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
R0078:Pitrm1 UTSW 13 6575032 missense probably damaging 0.99
R0085:Pitrm1 UTSW 13 6549568 splice site probably benign
R0089:Pitrm1 UTSW 13 6555639 missense probably damaging 1.00
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0478:Pitrm1 UTSW 13 6559395 missense probably damaging 0.99
R0496:Pitrm1 UTSW 13 6568714 missense probably damaging 1.00
R0781:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1110:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1170:Pitrm1 UTSW 13 6552744 splice site probably benign
R1373:Pitrm1 UTSW 13 6570700 missense probably benign 0.03
R1563:Pitrm1 UTSW 13 6563470 missense possibly damaging 0.85
R1897:Pitrm1 UTSW 13 6560095 missense possibly damaging 0.78
R1985:Pitrm1 UTSW 13 6558184 missense probably damaging 1.00
R2075:Pitrm1 UTSW 13 6555383 missense probably damaging 1.00
R2114:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2115:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2206:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2207:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2260:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R2568:Pitrm1 UTSW 13 6575092 missense probably benign 0.15
R3409:Pitrm1 UTSW 13 6578481 missense possibly damaging 0.81
R3756:Pitrm1 UTSW 13 6558235 missense probably damaging 1.00
R4020:Pitrm1 UTSW 13 6556687 missense probably damaging 1.00
R4327:Pitrm1 UTSW 13 6579773 utr 3 prime probably benign
R4540:Pitrm1 UTSW 13 6555470 critical splice donor site probably null
R4579:Pitrm1 UTSW 13 6558225 missense probably benign 0.05
R4659:Pitrm1 UTSW 13 6553182 missense probably benign 0.37
R4685:Pitrm1 UTSW 13 6556542 missense probably benign 0.00
R4888:Pitrm1 UTSW 13 6578560 missense probably damaging 1.00
R5072:Pitrm1 UTSW 13 6553190 missense probably damaging 1.00
R5159:Pitrm1 UTSW 13 6567471 missense probably benign 0.00
R5383:Pitrm1 UTSW 13 6577432 missense probably damaging 1.00
R5470:Pitrm1 UTSW 13 6553270 missense probably benign 0.07
R5606:Pitrm1 UTSW 13 6560065 missense probably damaging 1.00
R6224:Pitrm1 UTSW 13 6565054 missense probably damaging 1.00
R6302:Pitrm1 UTSW 13 6560061 missense probably damaging 0.99
R6898:Pitrm1 UTSW 13 6555459 missense probably damaging 1.00
R7021:Pitrm1 UTSW 13 6578557 missense probably damaging 0.99
R7249:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R7256:Pitrm1 UTSW 13 6556597 missense probably damaging 1.00
R7363:Pitrm1 UTSW 13 6569351 missense probably benign
R7502:Pitrm1 UTSW 13 6560622 missense probably damaging 0.97
R7647:Pitrm1 UTSW 13 6555408 missense probably damaging 1.00
R8392:Pitrm1 UTSW 13 6549660 missense probably benign 0.30
R8514:Pitrm1 UTSW 13 6568786 critical splice donor site probably null
R8745:Pitrm1 UTSW 13 6553202 missense probably damaging 1.00
R8772:Pitrm1 UTSW 13 6578560 missense probably damaging 1.00
R8934:Pitrm1 UTSW 13 6556630 missense probably benign 0.07
R9086:Pitrm1 UTSW 13 6577481 missense probably benign
R9369:Pitrm1 UTSW 13 6553244 missense probably benign 0.03
R9417:Pitrm1 UTSW 13 6567358 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCTGCTTTCACCGGAGGGAAATAC -3'
(R):5'- CATGTTAAAGGCCGCACTCATGC -3'

Sequencing Primer
(F):5'- GGCGTCTCGGATTTCAAAC -3'
(R):5'- TGCATGAACATGCTACACAC -3'
Posted On 2014-01-05