Incidental Mutation 'R1133:Olfr147'
ID94532
Institutional Source Beutler Lab
Gene Symbol Olfr147
Ensembl Gene ENSMUSG00000049098
Gene Nameolfactory receptor 147
SynonymsM3, GA_x6K02T2PVTD-32098059-32099003, MOR164-1
MMRRC Submission 039206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1133 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38401698-38407997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38403731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 283 (M283L)
Ref Sequence ENSEMBL: ENSMUSP00000149480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056364] [ENSMUST00000214648]
Predicted Effect probably benign
Transcript: ENSMUST00000056364
AA Change: M286L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051933
Gene: ENSMUSG00000049098
AA Change: M286L

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-48 PFAM
Pfam:7tm_1 44 292 2.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214648
AA Change: M283L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahr A G 12: 35,526,806 L42P probably damaging Het
B430305J03Rik C T 3: 61,364,009 W105* probably null Het
Gpr156 T A 16: 38,005,321 N633K probably benign Het
Hook2 T C 8: 84,995,804 L324P probably damaging Het
Socs4 A G 14: 47,290,194 I195M probably benign Het
Syne1 A G 10: 5,349,044 I1014T possibly damaging Het
Ttc30a2 G A 2: 75,977,383 Q262* probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Other mutations in Olfr147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Olfr147 APN 9 38403021 missense possibly damaging 0.67
IGL02109:Olfr147 APN 9 38403086 missense possibly damaging 0.91
IGL02805:Olfr147 APN 9 38403836 utr 3 prime probably benign
IGL02875:Olfr147 APN 9 38403176 missense probably damaging 0.99
R1446:Olfr147 UTSW 9 38403305 missense possibly damaging 0.73
R1591:Olfr147 UTSW 9 38402936 missense probably damaging 1.00
R1719:Olfr147 UTSW 9 38403254 missense possibly damaging 0.67
R1895:Olfr147 UTSW 9 38402886 start codon destroyed probably null 0.88
R1946:Olfr147 UTSW 9 38402886 start codon destroyed probably null 0.88
R1981:Olfr147 UTSW 9 38403735 missense probably damaging 0.99
R2033:Olfr147 UTSW 9 38403373 missense probably damaging 0.99
R4856:Olfr147 UTSW 9 38403468 missense probably damaging 1.00
R5322:Olfr147 UTSW 9 38403566 missense probably damaging 1.00
R6017:Olfr147 UTSW 9 38403620 missense probably benign 0.01
R6037:Olfr147 UTSW 9 38403305 missense probably benign 0.07
R6037:Olfr147 UTSW 9 38403305 missense probably benign 0.07
R7032:Olfr147 UTSW 9 38403669 missense possibly damaging 0.53
R7042:Olfr147 UTSW 9 38402900 missense probably damaging 0.98
R7351:Olfr147 UTSW 9 38403443 missense probably damaging 1.00
R7460:Olfr147 UTSW 9 38403353 missense possibly damaging 0.95
R7820:Olfr147 UTSW 9 38403566 missense probably damaging 1.00
R8161:Olfr147 UTSW 9 38403507 missense probably damaging 0.97
R8196:Olfr147 UTSW 9 38403608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGAGCAAAAGCCTTCAGCAC -3'
(R):5'- CCATATACATGATCTGCCTTCTTGCTGT -3'

Sequencing Primer
(F):5'- AGCCTTCAGCACCTGTAGC -3'
(R):5'- ATCAATCATTTGGATAGGCTGTTAGG -3'
Posted On2014-01-05