Incidental Mutation 'R1061:Ppp3cb'
ID 94535
Institutional Source Beutler Lab
Gene Symbol Ppp3cb
Ensembl Gene ENSMUSG00000021816
Gene Name protein phosphatase 3, catalytic subunit, beta isoform
Synonyms Calnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 20499364-20546573 bp(-) (GRCm38)
Type of Mutation splice site (10 bp from exon)
DNA Base Change (assembly) A to C at 20508614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
AlphaFold P48453
Predicted Effect probably null
Transcript: ENSMUST00000022355
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159027
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161445
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161989
AA Change: V460G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816
AA Change: V460G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162217
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Ppp3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20509449 missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20531658 critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site probably null
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
Copacabana UTSW 14 20530942 critical splice donor site probably null
eden_express UTSW 14 20528195 nonsense probably null
everglades UTSW 14 20530948 missense probably damaging 1.00
Havana UTSW 14 20531752 missense possibly damaging 0.85
justinian UTSW 14 20508543 missense possibly damaging 0.73
Prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20503241 splice site probably null
R1013:Ppp3cb UTSW 14 20524004 missense probably benign
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4509:Ppp3cb UTSW 14 20515501 intron probably benign
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20528195 nonsense probably null
R5586:Ppp3cb UTSW 14 20520690 splice site probably benign
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20531026 missense probably damaging 1.00
R7362:Ppp3cb UTSW 14 20523651 missense probably benign 0.00
R7493:Ppp3cb UTSW 14 20508551 missense probably benign 0.01
R8291:Ppp3cb UTSW 14 20523594 missense possibly damaging 0.89
R8438:Ppp3cb UTSW 14 20515590 missense probably damaging 0.99
R8515:Ppp3cb UTSW 14 20531776 missense probably benign 0.21
R8867:Ppp3cb UTSW 14 20546449 unclassified probably benign
R9136:Ppp3cb UTSW 14 20531799 missense probably benign 0.33
R9254:Ppp3cb UTSW 14 20531806 missense probably benign
R9379:Ppp3cb UTSW 14 20531806 missense probably benign
Z1177:Ppp3cb UTSW 14 20508518 missense unknown
Predicted Primers PCR Primer
(F):5'- GACATGAGCTGCTCCCCATATCAC -3'
(R):5'- TGGACTACATCTGGGCCATAGTTCTTC -3'

Sequencing Primer
(F):5'- CACCTTATGAAAATCTGGGAAACTG -3'
(R):5'- ggggatcaagcccagtg -3'
Posted On 2014-01-05