Incidental Mutation 'R1061:Btbd9'
ID 94548
Institutional Source Beutler Lab
Gene Symbol Btbd9
Ensembl Gene ENSMUSG00000062202
Gene Name BTB (POZ) domain containing 9
Synonyms 1700023F20Rik
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1061 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 30215524-30576287 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30527435 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000127300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]
AlphaFold Q8C726
Predicted Effect probably benign
Transcript: ENSMUST00000079924
AA Change: I139T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: I139T

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 283 405 3.9e-11 PFAM
Pfam:F5_F8_type_C 431 554 6.3e-12 PFAM
low complexity region 585 612 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168787
AA Change: I139T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: I139T

DomainStartEndE-ValueType
BTB 36 137 3.52e-25 SMART
BACK 143 240 1.84e-18 SMART
Pfam:F5_F8_type_C 278 405 1.1e-8 PFAM
Pfam:F5_F8_type_C 433 554 1.4e-8 PFAM
low complexity region 585 612 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gli2 A T 1: 118,854,517 M160K possibly damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Btbd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Btbd9 APN 17 30299601 missense possibly damaging 0.71
IGL01651:Btbd9 APN 17 30220417 missense unknown
IGL01814:Btbd9 APN 17 30299535 missense probably benign 0.01
IGL01820:Btbd9 APN 17 30527409 missense possibly damaging 0.82
IGL02014:Btbd9 APN 17 30517150 missense probably damaging 0.98
IGL02075:Btbd9 APN 17 30274936 nonsense probably null
IGL02390:Btbd9 APN 17 30524814 missense probably benign 0.22
IGL02414:Btbd9 APN 17 30220559 missense possibly damaging 0.95
IGL02748:Btbd9 APN 17 30334297 missense possibly damaging 0.81
crumbs UTSW 17 30299736 splice site probably null
grain UTSW 17 30274942 missense possibly damaging 0.92
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0023:Btbd9 UTSW 17 30530214 missense probably damaging 0.96
R0122:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0123:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0134:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0189:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0190:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0226:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0268:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0344:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0427:Btbd9 UTSW 17 30274942 missense possibly damaging 0.92
R0462:Btbd9 UTSW 17 30530217 missense possibly damaging 0.82
R0645:Btbd9 UTSW 17 30524967 missense probably damaging 0.96
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0973:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R0974:Btbd9 UTSW 17 30299633 missense probably damaging 0.99
R1763:Btbd9 UTSW 17 30334297 missense possibly damaging 0.81
R1781:Btbd9 UTSW 17 30513593 missense probably damaging 1.00
R1902:Btbd9 UTSW 17 30530228 missense probably damaging 0.98
R1995:Btbd9 UTSW 17 30274930 missense possibly damaging 0.93
R2224:Btbd9 UTSW 17 30527346 missense probably damaging 0.98
R2237:Btbd9 UTSW 17 30334328 missense probably benign
R3684:Btbd9 UTSW 17 30334307 missense probably damaging 0.99
R3800:Btbd9 UTSW 17 30513659 missense possibly damaging 0.89
R4403:Btbd9 UTSW 17 30485932 intron probably benign
R4492:Btbd9 UTSW 17 30527571 missense probably damaging 0.99
R4654:Btbd9 UTSW 17 30485587 intron probably benign
R4854:Btbd9 UTSW 17 30524865 missense probably damaging 0.98
R5710:Btbd9 UTSW 17 30228868 missense probably benign 0.16
R5963:Btbd9 UTSW 17 30334218 splice site probably null
R6295:Btbd9 UTSW 17 30299736 splice site probably null
R6422:Btbd9 UTSW 17 30530256 missense probably benign
R7023:Btbd9 UTSW 17 30527572 missense probably benign 0.02
R7826:Btbd9 UTSW 17 30334327 missense probably benign 0.42
R7922:Btbd9 UTSW 17 30274884 missense probably benign 0.01
R7962:Btbd9 UTSW 17 30517203 missense probably damaging 0.99
R8265:Btbd9 UTSW 17 30334304 missense possibly damaging 0.86
R8786:Btbd9 UTSW 17 30530170 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCAGATGACTGCTTTGAGCGAG -3'
(R):5'- CATTACTGTATGGCGGGATGCGAG -3'

Sequencing Primer
(F):5'- AGGGTTTTGATTCTTGGACCAC -3'
(R):5'- GAAGCAGAGATCCCTCTCCAAG -3'
Posted On 2014-01-05