Incidental Mutation 'R1133:Socs4'
ID94553
Institutional Source Beutler Lab
Gene Symbol Socs4
Ensembl Gene ENSMUSG00000048379
Gene Namesuppressor of cytokine signaling 4
SynonymsSocs7
MMRRC Submission 039206-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R1133 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47276931-47296102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47290194 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 195 (I195M)
Ref Sequence ENSEMBL: ENSMUSP00000066031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000227413]
Predicted Effect probably benign
Transcript: ENSMUST00000065562
AA Change: I195M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379
AA Change: I195M

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
Pfam:SOCS 55 108 6.8e-23 PFAM
low complexity region 219 232 N/A INTRINSIC
SH2 281 367 1.11e-16 SMART
SOCS 377 420 1.69e-16 SMART
SOCS_box 383 419 1.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227413
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahr A G 12: 35,526,806 L42P probably damaging Het
B430305J03Rik C T 3: 61,364,009 W105* probably null Het
Gpr156 T A 16: 38,005,321 N633K probably benign Het
Hook2 T C 8: 84,995,804 L324P probably damaging Het
Olfr147 A T 9: 38,403,731 M283L probably benign Het
Syne1 A G 10: 5,349,044 I1014T possibly damaging Het
Ttc30a2 G A 2: 75,977,383 Q262* probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Other mutations in Socs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Socs4 APN 14 47290252 missense probably benign
IGL01942:Socs4 APN 14 47290650 nonsense probably null
IGL02039:Socs4 APN 14 47290193 missense probably benign
IGL02117:Socs4 APN 14 47290807 missense probably damaging 1.00
R0281:Socs4 UTSW 14 47289868 missense probably benign 0.25
R0703:Socs4 UTSW 14 47290048 missense probably damaging 1.00
R0763:Socs4 UTSW 14 47290655 missense probably damaging 1.00
R0842:Socs4 UTSW 14 47289969 missense probably damaging 0.98
R1280:Socs4 UTSW 14 47290913 missense probably benign 0.23
R1619:Socs4 UTSW 14 47290283 missense possibly damaging 0.87
R1632:Socs4 UTSW 14 47289577 start gained probably benign
R5058:Socs4 UTSW 14 47290132 nonsense probably null
R6008:Socs4 UTSW 14 47290161 missense probably damaging 0.98
R6648:Socs4 UTSW 14 47290176 missense probably benign 0.02
R6925:Socs4 UTSW 14 47289738 nonsense probably null
R7408:Socs4 UTSW 14 47289839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGACACACTGTTCCTATGAGTCCC -3'
(R):5'- TTGTCCATGACACCCCAGTAGCAC -3'

Sequencing Primer
(F):5'- CTATGAGTCCCAACTCAGATGAATGG -3'
(R):5'- CACGGATTGTTACTGATCTGAAG -3'
Posted On2014-01-05