Incidental Mutation 'R1133:Gpr156'
ID94561
Institutional Source Beutler Lab
Gene Symbol Gpr156
Ensembl Gene ENSMUSG00000046961
Gene NameG protein-coupled receptor 156
SynonymsGababl
MMRRC Submission 039206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1133 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37916496-38007530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38005321 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 633 (N633K)
Ref Sequence ENSEMBL: ENSMUSP00000055958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061274]
Predicted Effect probably benign
Transcript: ENSMUST00000061274
AA Change: N633K

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: N633K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:7tm_3 61 313 2.6e-37 PFAM
coiled coil region 353 390 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
low complexity region 681 716 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahr A G 12: 35,526,806 L42P probably damaging Het
B430305J03Rik C T 3: 61,364,009 W105* probably null Het
Hook2 T C 8: 84,995,804 L324P probably damaging Het
Olfr147 A T 9: 38,403,731 M283L probably benign Het
Socs4 A G 14: 47,290,194 I195M probably benign Het
Syne1 A G 10: 5,349,044 I1014T possibly damaging Het
Ttc30a2 G A 2: 75,977,383 Q262* probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Other mutations in Gpr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Gpr156 APN 16 37988576 missense probably damaging 1.00
IGL01615:Gpr156 APN 16 37988591 missense probably damaging 1.00
IGL01976:Gpr156 APN 16 37979033 missense probably damaging 0.97
IGL02217:Gpr156 APN 16 38005311 missense probably benign 0.19
IGL02515:Gpr156 APN 16 38005679 missense probably damaging 0.97
IGL02596:Gpr156 APN 16 37978724 missense probably benign 0.00
IGL03068:Gpr156 APN 16 37992129 missense probably damaging 0.99
R0690:Gpr156 UTSW 16 37992141 missense probably damaging 1.00
R1034:Gpr156 UTSW 16 38004726 missense probably benign
R1317:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1437:Gpr156 UTSW 16 37988542 missense probably damaging 0.99
R1484:Gpr156 UTSW 16 37992196 missense probably damaging 0.99
R1759:Gpr156 UTSW 16 37948221 missense probably damaging 0.96
R1761:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1998:Gpr156 UTSW 16 37997908 missense possibly damaging 0.57
R2067:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2111:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2509:Gpr156 UTSW 16 37947787 missense probably benign 0.04
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R3839:Gpr156 UTSW 16 37988600 missense probably damaging 0.99
R4492:Gpr156 UTSW 16 37992106 missense probably damaging 0.99
R4988:Gpr156 UTSW 16 37948215 missense possibly damaging 0.71
R5329:Gpr156 UTSW 16 38005448 missense probably benign 0.00
R5361:Gpr156 UTSW 16 38005725 missense probably damaging 0.99
R5386:Gpr156 UTSW 16 37948309 missense possibly damaging 0.93
R5531:Gpr156 UTSW 16 38005257 missense probably benign 0.01
R5886:Gpr156 UTSW 16 37979013 missense probably damaging 1.00
R5942:Gpr156 UTSW 16 38004902 missense probably benign 0.04
R6345:Gpr156 UTSW 16 37987519 missense probably damaging 1.00
R7247:Gpr156 UTSW 16 37947741 missense probably damaging 1.00
R7353:Gpr156 UTSW 16 37992161 missense probably damaging 1.00
R7954:Gpr156 UTSW 16 37987558 missense probably damaging 0.97
R8316:Gpr156 UTSW 16 37997974 missense probably null 0.00
R8333:Gpr156 UTSW 16 37992054 missense probably damaging 1.00
R8507:Gpr156 UTSW 16 37948236 missense probably benign
Z1177:Gpr156 UTSW 16 38004863 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GCTGTCCCCATCTAAACTGGGTTTC -3'
(R):5'- TGAGCTGCTGGACTCACTGTCAAG -3'

Sequencing Primer
(F):5'- GGGGCATCAAGCAAATAGTACC -3'
(R):5'- CACTGTCAAGGTTGTAGCAC -3'
Posted On2014-01-05