Incidental Mutation 'R1131:Commd7'
ID94588
Institutional Source Beutler Lab
Gene Symbol Commd7
Ensembl Gene ENSMUSG00000056941
Gene NameCOMM domain containing 7
SynonymsmU3, 2310010I22Rik
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location153616933-153632781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153622127 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 44 (Q44L)
Ref Sequence ENSEMBL: ENSMUSP00000105404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071852] [ENSMUST00000109782]
Predicted Effect probably benign
Transcript: ENSMUST00000071852
AA Change: Q115L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071752
Gene: ENSMUSG00000056941
AA Change: Q115L

DomainStartEndE-ValueType
Pfam:HCaRG 19 199 3.8e-44 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000109782
AA Change: Q44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105404
Gene: ENSMUSG00000056941
AA Change: Q44L

DomainStartEndE-ValueType
Pfam:HCaRG 1 127 4.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147822
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Commd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03392:Commd7 APN 2 153622764 splice site probably benign
R1065:Commd7 UTSW 2 153619527 splice site probably benign
R2132:Commd7 UTSW 2 153621666 intron probably benign
R3897:Commd7 UTSW 2 153622790 missense probably benign
R5837:Commd7 UTSW 2 153629224 missense possibly damaging 0.79
R5902:Commd7 UTSW 2 153621817 missense probably damaging 1.00
R6207:Commd7 UTSW 2 153632610 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGAGCAGCCATGTTGGGGTAAAC -3'
(R):5'- TCCTGATGCCCTGCTGAAAGAATG -3'

Sequencing Primer
(F):5'- GTCTGAGATCAAGGACAAGTCTTCC -3'
(R):5'- ccctgctgaaagaaTGATTGTATTCC -3'
Posted On2014-01-05