Incidental Mutation 'R1131:4930503B20Rik'
ID94595
Institutional Source Beutler Lab
Gene Symbol 4930503B20Rik
Ensembl Gene ENSMUSG00000090202
Gene NameRIKEN cDNA 4930503B20 gene
Synonyms
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146645193-146651317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 146651082 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 24 (H24N)
Ref Sequence ENSEMBL: ENSMUSP00000051453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049703] [ENSMUST00000124931] [ENSMUST00000125965] [ENSMUST00000147113] [ENSMUST00000149825] [ENSMUST00000197989]
Predicted Effect probably damaging
Transcript: ENSMUST00000049703
AA Change: H24N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051453
Gene: ENSMUSG00000090202
AA Change: H24N

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124931
SMART Domains Protein: ENSMUSP00000118464
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125965
SMART Domains Protein: ENSMUSP00000119608
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141199
Predicted Effect probably benign
Transcript: ENSMUST00000147113
SMART Domains Protein: ENSMUSP00000118934
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 28 94 3.66e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149825
AA Change: H24N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114745
Gene: ENSMUSG00000090202
AA Change: H24N

DomainStartEndE-ValueType
DnaJ 2 61 1.21e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154128
Predicted Effect probably benign
Transcript: ENSMUST00000197989
SMART Domains Protein: ENSMUSP00000143496
Gene: ENSMUSG00000048652

DomainStartEndE-ValueType
SAM 9 75 2.2e-4 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in 4930503B20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:4930503B20Rik UTSW 3 146650496 missense probably benign
R1523:4930503B20Rik UTSW 3 146651109 missense probably damaging 1.00
R2281:4930503B20Rik UTSW 3 146646424 missense probably damaging 0.99
R2520:4930503B20Rik UTSW 3 146650506 missense probably damaging 0.99
R3896:4930503B20Rik UTSW 3 146651113 missense possibly damaging 0.88
R4300:4930503B20Rik UTSW 3 146650920 nonsense probably null
R5196:4930503B20Rik UTSW 3 146646263 utr 3 prime probably benign
R5394:4930503B20Rik UTSW 3 146650608 missense probably damaging 1.00
R5394:4930503B20Rik UTSW 3 146650958 missense probably damaging 1.00
R5645:4930503B20Rik UTSW 3 146650509 missense probably damaging 0.98
R5894:4930503B20Rik UTSW 3 146650925 missense probably benign 0.40
R6574:4930503B20Rik UTSW 3 146650858 missense probably benign 0.02
R6830:4930503B20Rik UTSW 3 146650961 missense possibly damaging 0.90
R7604:4930503B20Rik UTSW 3 146650660 nonsense probably null
Z1176:4930503B20Rik UTSW 3 146650956 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCGTTAACTCTGATGGTCTCC -3'
(R):5'- CGTGTGAAGGTTCAATTCGCTGAAG -3'

Sequencing Primer
(F):5'- AACTCTGATGGTCTCCCCTTTG -3'
(R):5'- GAATTTCTCCACCAGAAGAGGC -3'
Posted On2014-01-05