Incidental Mutation 'R1023:Slc1a7'
ID94600
Institutional Source Beutler Lab
Gene Symbol Slc1a7
Ensembl Gene ENSMUSG00000008932
Gene Namesolute carrier family 1 (glutamate transporter), member 7
SynonymsEAAT5
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107968332-108013532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108007573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 270 (V270M)
Ref Sequence ENSEMBL: ENSMUSP00000102324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106713]
Predicted Effect probably damaging
Transcript: ENSMUST00000106713
AA Change: V270M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102324
Gene: ENSMUSG00000008932
AA Change: V270M

DomainStartEndE-ValueType
Pfam:SDF 29 485 1.9e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124190
Meta Mutation Damage Score 0.4090 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Slc1a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Slc1a7 APN 4 107992965 missense probably damaging 1.00
IGL02643:Slc1a7 APN 4 108012300 missense possibly damaging 0.86
IGL03146:Slc1a7 APN 4 107992992 missense probably damaging 0.98
R1629:Slc1a7 UTSW 4 108008143 missense probably damaging 1.00
R1869:Slc1a7 UTSW 4 108008364 missense probably damaging 1.00
R1957:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1970:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R1971:Slc1a7 UTSW 4 107968585 missense probably benign 0.05
R2058:Slc1a7 UTSW 4 108004439 missense probably benign 0.41
R2201:Slc1a7 UTSW 4 107993006 missense probably damaging 1.00
R2212:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3412:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3413:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3414:Slc1a7 UTSW 4 108010994 missense probably benign 0.02
R3734:Slc1a7 UTSW 4 107977644 missense probably damaging 1.00
R4109:Slc1a7 UTSW 4 107968661 missense probably benign 0.22
R4662:Slc1a7 UTSW 4 108007554 missense probably damaging 1.00
R4676:Slc1a7 UTSW 4 107977674 missense possibly damaging 0.95
R4801:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4802:Slc1a7 UTSW 4 107993040 missense probably damaging 1.00
R4935:Slc1a7 UTSW 4 108007561 missense probably damaging 1.00
R5896:Slc1a7 UTSW 4 108012390 missense probably benign 0.02
R5947:Slc1a7 UTSW 4 108010300 unclassified probably benign
R6056:Slc1a7 UTSW 4 108012261 missense probably benign 0.00
R6088:Slc1a7 UTSW 4 108012444 missense probably damaging 1.00
R6134:Slc1a7 UTSW 4 108012436 missense probably damaging 1.00
R6141:Slc1a7 UTSW 4 108002182 missense possibly damaging 0.50
R7378:Slc1a7 UTSW 4 108002203 missense possibly damaging 0.50
R7587:Slc1a7 UTSW 4 108010486 missense possibly damaging 0.93
R8002:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8003:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8022:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
R8023:Slc1a7 UTSW 4 108012276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTGCCTCTGAAGCCGGGAAATG -3'
(R):5'- AGGTCTGAACTCTGAACCAGGAGTG -3'

Sequencing Primer
(F):5'- GTTTTCTGTCAAAGCAGACCAGAC -3'
(R):5'- CTTTCTTCAAGAGCCGAGCTAAG -3'
Posted On2014-01-05