Incidental Mutation 'R1023:Col9a2'
ID94604
Institutional Source Beutler Lab
Gene Symbol Col9a2
Ensembl Gene ENSMUSG00000028626
Gene Namecollagen, type IX, alpha 2
SynonymsCol9a-2
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location121039385-121055322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121044010 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 118 (G118R)
Ref Sequence ENSEMBL: ENSMUSP00000030372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030372]
Predicted Effect unknown
Transcript: ENSMUST00000030372
AA Change: G118R
SMART Domains Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: G118R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Collagen 24 82 7.3e-12 PFAM
Pfam:Collagen 59 115 2.4e-10 PFAM
Pfam:Collagen 113 170 2e-8 PFAM
Pfam:Collagen 176 236 8.9e-11 PFAM
low complexity region 258 277 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
Pfam:Collagen 357 435 4.4e-8 PFAM
Pfam:Collagen 459 523 6.1e-11 PFAM
Pfam:Collagen 548 610 4.5e-11 PFAM
low complexity region 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151987
Meta Mutation Damage Score 0.7215 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Col9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Col9a2 APN 4 121045192 missense possibly damaging 0.95
IGL01978:Col9a2 APN 4 121044666 missense unknown
IGL01995:Col9a2 APN 4 121050410 critical splice donor site probably null
IGL02162:Col9a2 APN 4 121054334 unclassified probably benign
IGL02931:Col9a2 APN 4 121053192 missense probably benign 0.06
gravity_wave UTSW 4 121044019 critical splice donor site probably null
R0208:Col9a2 UTSW 4 121052288 splice site probably benign
R0426:Col9a2 UTSW 4 121044660 splice site probably benign
R0512:Col9a2 UTSW 4 121054307 missense probably benign 0.22
R0973:Col9a2 UTSW 4 121039788 critical splice donor site probably null
R1657:Col9a2 UTSW 4 121040974 missense unknown
R1724:Col9a2 UTSW 4 121053902 missense probably damaging 1.00
R2171:Col9a2 UTSW 4 121045001 nonsense probably null
R2206:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2221:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2223:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2273:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2274:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2275:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2354:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2392:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2393:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R2394:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3421:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3426:Col9a2 UTSW 4 121050407 missense possibly damaging 0.93
R3710:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3821:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3838:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R3839:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4067:Col9a2 UTSW 4 121052389 missense probably damaging 1.00
R4298:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4299:Col9a2 UTSW 4 121054258 missense probably damaging 0.98
R4595:Col9a2 UTSW 4 121045155 missense probably benign 0.04
R4942:Col9a2 UTSW 4 121053119 missense possibly damaging 0.73
R5120:Col9a2 UTSW 4 121039772 missense unknown
R5434:Col9a2 UTSW 4 121040965 nonsense probably null
R6143:Col9a2 UTSW 4 121053863 missense probably damaging 0.99
R7027:Col9a2 UTSW 4 121044019 critical splice donor site probably null
R7056:Col9a2 UTSW 4 121049716 critical splice donor site probably null
R7417:Col9a2 UTSW 4 121054292 missense not run
R7571:Col9a2 UTSW 4 121039784 missense unknown
Z1176:Col9a2 UTSW 4 121053797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCACTGACGACACACTAAGG -3'
(R):5'- CAACTCCCAGCAGACAGAGCTTATG -3'

Sequencing Primer
(F):5'- TCTAGAAGGCTCTAGCCGC -3'
(R):5'- TTATGAGGCTGTAAGGACCAGG -3'
Posted On2014-01-05