Incidental Mutation 'R1131:Vmn1r42'
ID94608
Institutional Source Beutler Lab
Gene Symbol Vmn1r42
Ensembl Gene ENSMUSG00000068232
Gene Namevomeronasal 1 receptor 42
SynonymsV1ra6
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89842573-89876413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89845569 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 6 (F6Y)
Ref Sequence ENSEMBL: ENSMUSP00000154442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089419] [ENSMUST00000226436] [ENSMUST00000227279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089419
AA Change: F6Y

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086840
Gene: ENSMUSG00000068232
AA Change: F6Y

DomainStartEndE-ValueType
Pfam:V1R 54 318 3.6e-132 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226436
AA Change: F6Y

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227279
AA Change: F6Y

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Other mutations in Vmn1r42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02055:Vmn1r42 APN 6 89845589 utr 5 prime probably benign
IGL02151:Vmn1r42 APN 6 89845041 missense possibly damaging 0.90
IGL02158:Vmn1r42 APN 6 89845314 missense probably damaging 0.96
IGL02731:Vmn1r42 APN 6 89845425 missense probably benign 0.41
IGL02738:Vmn1r42 APN 6 89844648 missense possibly damaging 0.69
IGL02817:Vmn1r42 APN 6 89845536 missense probably damaging 1.00
volkan UTSW 6 89844967 missense probably benign 0.00
R1500:Vmn1r42 UTSW 6 89845501 missense probably benign 0.01
R1557:Vmn1r42 UTSW 6 89844751 missense possibly damaging 0.66
R1561:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1574:Vmn1r42 UTSW 6 89845381 missense probably damaging 0.99
R1574:Vmn1r42 UTSW 6 89845077 missense possibly damaging 0.62
R1857:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1858:Vmn1r42 UTSW 6 89844615 missense probably benign 0.28
R1916:Vmn1r42 UTSW 6 89844967 missense probably benign 0.00
R2284:Vmn1r42 UTSW 6 89844699 missense probably benign 0.26
R2912:Vmn1r42 UTSW 6 89844706 missense probably benign
R4541:Vmn1r42 UTSW 6 89845551 missense probably benign
R5085:Vmn1r42 UTSW 6 89844616 missense probably benign 0.00
R5384:Vmn1r42 UTSW 6 89845384 missense probably damaging 1.00
R5616:Vmn1r42 UTSW 6 89845102 missense possibly damaging 0.66
R5647:Vmn1r42 UTSW 6 89845332 missense probably benign 0.43
R5867:Vmn1r42 UTSW 6 89844779 nonsense probably null
R6569:Vmn1r42 UTSW 6 89845443 missense probably damaging 1.00
R6852:Vmn1r42 UTSW 6 89844787 missense possibly damaging 0.71
R7054:Vmn1r42 UTSW 6 89845069 missense possibly damaging 0.90
R7399:Vmn1r42 UTSW 6 89845513 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCCTGTGCCCACGAATGAACTTTAG -3'
(R):5'- CCAAATACGATGCTGTTCCTGCTCC -3'

Sequencing Primer
(F):5'- CACGAATGAACTTTAGGATGTGGAC -3'
(R):5'- TCCTGCTCCAGGAAAAAAAAATTAC -3'
Posted On2014-01-05