Incidental Mutation 'R1023:Lap3'
ID94611
Institutional Source Beutler Lab
Gene Symbol Lap3
Ensembl Gene ENSMUSG00000039682
Gene Nameleucine aminopeptidase 3
SynonymsPep-7, LAP, peptidase S, Pep-S, Pep7
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45493374-45512691 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 45495211 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 50 (P50S)
Ref Sequence ENSEMBL: ENSMUSP00000040222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046122] [ENSMUST00000198534]
Predicted Effect probably benign
Transcript: ENSMUST00000046122
AA Change: P50S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000040222
Gene: ENSMUSG00000039682
AA Change: P50S

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:Peptidase_M17_N 37 169 1.5e-21 PFAM
Pfam:Peptidase_M17 197 508 1.3e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137699
Predicted Effect probably benign
Transcript: ENSMUST00000198534
AA Change: P28S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142831
Gene: ENSMUSG00000039682
AA Change: P28S

DomainStartEndE-ValueType
SCOP:d1lam_1 11 56 2e-10 SMART
PDB:1LCP|B 12 107 5e-25 PDB
SCOP:d1lam_2 63 106 2e-12 SMART
Meta Mutation Damage Score 0.0990 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no detectable abnormalities in generating peptides presented by MHC class I under constitutive conditions or after stimulation with IFN. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Lap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lap3 APN 5 45506169 unclassified probably benign
IGL00945:Lap3 APN 5 45504773 unclassified probably null
IGL01694:Lap3 APN 5 45498595 critical splice donor site probably null
IGL02427:Lap3 APN 5 45511133 missense probably damaging 0.99
IGL02751:Lap3 APN 5 45504796 missense probably damaging 1.00
R0110:Lap3 UTSW 5 45495290 splice site probably benign
R0666:Lap3 UTSW 5 45511928 missense possibly damaging 0.53
R1157:Lap3 UTSW 5 45507148 missense probably damaging 1.00
R1294:Lap3 UTSW 5 45498521 missense probably benign 0.03
R1449:Lap3 UTSW 5 45509519 critical splice donor site probably null
R1869:Lap3 UTSW 5 45503387 missense probably benign 0.00
R1900:Lap3 UTSW 5 45511910 missense probably damaging 1.00
R1971:Lap3 UTSW 5 45506166 unclassified probably benign
R2009:Lap3 UTSW 5 45493557 missense probably benign 0.37
R4171:Lap3 UTSW 5 45509491 missense probably benign 0.45
R4708:Lap3 UTSW 5 45511138 missense probably damaging 1.00
R4941:Lap3 UTSW 5 45506197 missense probably benign 0.19
R5558:Lap3 UTSW 5 45504751 missense probably benign 0.00
R5761:Lap3 UTSW 5 45504805 missense probably benign 0.01
R5893:Lap3 UTSW 5 45511279 intron probably benign
R6407:Lap3 UTSW 5 45511925 missense probably damaging 1.00
R7144:Lap3 UTSW 5 45496948 missense probably benign 0.00
R7161:Lap3 UTSW 5 45498467 missense probably benign 0.23
R7489:Lap3 UTSW 5 45500506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATAACCCAGTTCCAGTCTTGCC -3'
(R):5'- TCCGCGTCAATCCTTCACAATAGG -3'

Sequencing Primer
(F):5'- AGGCTGCTGCTCTGCTC -3'
(R):5'- gggaatgaggcaggtgg -3'
Posted On2014-01-05