Incidental Mutation 'R1131:Clec9a'
ID94614
Institutional Source Beutler Lab
Gene Symbol Clec9a
Ensembl Gene ENSMUSG00000046080
Gene NameC-type lectin domain family 9, member a
Synonyms9830005G06Rik, DNGR-1
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129408862-129424763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129410315 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 44 (C44W)
Ref Sequence ENSEMBL: ENSMUSP00000144990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032262] [ENSMUST00000058352] [ENSMUST00000088075] [ENSMUST00000164513] [ENSMUST00000204860]
Predicted Effect probably benign
Transcript: ENSMUST00000032262
SMART Domains Protein: ENSMUSP00000032262
Gene: ENSMUSG00000030159

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
CLECT 102 217 1.59e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000058352
AA Change: C44W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056625
Gene: ENSMUSG00000046080
AA Change: C44W

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
CLECT 137 256 8.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088075
AA Change: C44W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085394
Gene: ENSMUSG00000046080
AA Change: C44W

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
CLECT 111 230 8.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133061
Predicted Effect probably benign
Transcript: ENSMUST00000164513
SMART Domains Protein: ENSMUSP00000128622
Gene: ENSMUSG00000046080

DomainStartEndE-ValueType
CLECT 110 229 8.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204860
AA Change: C44W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144990
Gene: ENSMUSG00000046080
AA Change: C44W

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLEC9A is a group V C-type lectin-like receptor (CTLR) that functions as an activation receptor and is expressed on myeloid lineage cells (Huysamen et al., 2008 [PubMed 18408006]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Homozygous null mice have CD8alpha+ dendritic cells that are defective in cross-presentation of dead-cell associated antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Ddias A T 7: 92,859,886 S274T possibly damaging Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Clec9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Clec9a APN 6 129421155 missense probably benign 0.35
PIT4468001:Clec9a UTSW 6 129419634 critical splice donor site probably null
R0408:Clec9a UTSW 6 129419569 missense possibly damaging 0.87
R1888:Clec9a UTSW 6 129410286 missense probably benign
R1888:Clec9a UTSW 6 129410286 missense probably benign
R2085:Clec9a UTSW 6 129410311 missense probably benign 0.07
R2095:Clec9a UTSW 6 129416358 missense possibly damaging 0.84
R3418:Clec9a UTSW 6 129421038 intron probably benign
R4731:Clec9a UTSW 6 129416336 missense probably benign 0.13
R6547:Clec9a UTSW 6 129416376 missense probably benign 0.01
R7728:Clec9a UTSW 6 129415235 missense possibly damaging 0.93
R8078:Clec9a UTSW 6 129409033 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCCCATGCTATAAGGTTCATCTGAGAG -3'
(R):5'- GGCTACTCAAGCTTTGCTGGCTAAC -3'

Sequencing Primer
(F):5'- AAGGTTCATCTGAGAGAATTTAAGC -3'
(R):5'- CACTCTACAGTGATACAGTGGTTC -3'
Posted On2014-01-05