Incidental Mutation 'R1023:Cd163l1'
ID94631
Institutional Source Beutler Lab
Gene Symbol Cd163l1
Ensembl Gene ENSMUSG00000025461
Gene NameCD163 molecule-like 1
SynonymsE430002D04Rik, Scart1
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1023 (G1)
Quality Score193
Status Validated
Chromosome7
Chromosomal Location140218267-140231145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140224463 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 484 (C484S)
Ref Sequence ENSEMBL: ENSMUSP00000147864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084460] [ENSMUST00000209398] [ENSMUST00000209637]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084460
AA Change: C484S

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081497
Gene: ENSMUSG00000025461
AA Change: C484S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SR 32 132 1.45e-30 SMART
SR 139 230 4.28e-6 SMART
SR 235 333 2.76e-36 SMART
SR 335 435 1.32e-33 SMART
SR 441 541 5.01e-25 SMART
SR 546 646 7.16e-53 SMART
SR 651 752 3.44e-14 SMART
SR 780 880 8.96e-45 SMART
low complexity region 882 898 N/A INTRINSIC
transmembrane domain 907 929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209376
Predicted Effect possibly damaging
Transcript: ENSMUST00000209398
AA Change: C484S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209637
AA Change: C484S

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211540
Meta Mutation Damage Score 0.3301 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Cd163l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cd163l1 APN 7 140224639 critical splice donor site probably null
IGL01921:Cd163l1 APN 7 140228719 nonsense probably null
IGL02168:Cd163l1 APN 7 140223486 missense probably benign 0.02
IGL02306:Cd163l1 APN 7 140223356 missense probably damaging 1.00
IGL02323:Cd163l1 APN 7 140228659 missense probably benign 0.10
IGL02457:Cd163l1 APN 7 140220395 missense probably benign 0.07
IGL02543:Cd163l1 APN 7 140220578 missense probably benign 0.00
IGL02831:Cd163l1 APN 7 140228521 missense probably benign 0.14
IGL03289:Cd163l1 APN 7 140229060 critical splice donor site probably null
lop UTSW 7 140224463 missense possibly damaging 0.91
R0357:Cd163l1 UTSW 7 140227895 missense probably damaging 1.00
R0513:Cd163l1 UTSW 7 140224960 nonsense probably null
R1519:Cd163l1 UTSW 7 140228156 missense probably benign 0.07
R1711:Cd163l1 UTSW 7 140220609 missense probably damaging 1.00
R2327:Cd163l1 UTSW 7 140223977 missense possibly damaging 0.48
R4957:Cd163l1 UTSW 7 140228522 missense probably damaging 0.99
R5421:Cd163l1 UTSW 7 140223900 missense probably damaging 1.00
R5422:Cd163l1 UTSW 7 140224155 missense probably benign 0.03
R5851:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
R5906:Cd163l1 UTSW 7 140228799 missense probably damaging 1.00
R5930:Cd163l1 UTSW 7 140230446 missense probably benign 0.32
R6376:Cd163l1 UTSW 7 140228729 missense probably damaging 1.00
R7380:Cd163l1 UTSW 7 140224877 missense possibly damaging 0.47
R7389:Cd163l1 UTSW 7 140228791 missense possibly damaging 0.95
R7466:Cd163l1 UTSW 7 140220706 critical splice donor site probably null
R7686:Cd163l1 UTSW 7 140222203 nonsense probably null
R7722:Cd163l1 UTSW 7 140222386 nonsense probably null
Z1176:Cd163l1 UTSW 7 140224857 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTCCTGCCAGGACTCCAAGACATC -3'
(R):5'- TGTAGGTCCCAGGCATCATCACAC -3'

Sequencing Primer
(F):5'- ATCCTGCGGCTGAGAGATG -3'
(R):5'- CACCTAACTGGATATCACGAGGG -3'
Posted On2014-01-05